Incidental Mutation 'R7813:Ptprt'
ID601280
Institutional Source Beutler Lab
Gene Symbol Ptprt
Ensembl Gene ENSMUSG00000053141
Gene Nameprotein tyrosine phosphatase, receptor type, T
SynonymsRPTPrho
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R7813 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location161521990-162661147 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 161530493 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 1420 (V1420M)
Ref Sequence ENSEMBL: ENSMUSP00000105067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]
Predicted Effect probably damaging
Transcript: ENSMUST00000109441
AA Change: V1420M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: V1420M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1159 3.64e-129 SMART
PTPc 1188 1453 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109442
AA Change: V1419M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: V1419M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 738 749 N/A INTRINSIC
transmembrane domain 772 791 N/A INTRINSIC
PTPc 901 1158 5.56e-134 SMART
PTPc 1187 1452 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109443
AA Change: V1410M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: V1410M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 778 792 N/A INTRINSIC
PTPc 892 1149 5.56e-134 SMART
PTPc 1178 1443 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109445
AA Change: V1400M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: V1400M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1139 5.56e-134 SMART
PTPc 1168 1433 4.24e-98 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik G A 10: 29,224,900 R423K probably benign Het
Acot7 T C 4: 152,223,118 S170P probably damaging Het
Arhgap40 A G 2: 158,538,700 Q341R probably benign Het
Arhgef28 T C 13: 97,945,681 E1206G possibly damaging Het
Arpp21 T A 9: 112,179,065 K122N probably damaging Het
Arsi T C 18: 60,916,654 L203P possibly damaging Het
C1rb A T 6: 124,580,529 I542F probably benign Het
Cadm3 C A 1: 173,344,389 V206L probably benign Het
Card11 T C 5: 140,899,664 D380G probably damaging Het
Ccdc42 A T 11: 68,597,708 Q164L probably benign Het
Ccnd1 A G 7: 144,937,885 probably null Het
Cep120 T C 18: 53,738,506 D98G probably damaging Het
Chrd A G 16: 20,735,405 T336A probably benign Het
Clca2 C A 3: 145,084,965 A449S probably benign Het
Dnah7a A G 1: 53,618,086 F844L probably benign Het
Fbxo11 T A 17: 88,000,817 I480F Het
Fcrl5 A G 3: 87,443,623 T147A probably benign Het
Gm15130 T A 2: 111,138,975 I133F Het
Gpr155 C T 2: 73,381,985 W98* probably null Het
Hspa4 A G 11: 53,272,036 S408P probably damaging Het
Il12rb2 G A 6: 67,356,651 R215C possibly damaging Het
Itga5 T A 15: 103,357,314 probably null Het
Kcnip3 T A 2: 127,481,783 probably null Het
Krt12 A G 11: 99,418,483 probably null Het
March3 A T 18: 56,783,091 S177R probably benign Het
Minpp1 T G 19: 32,491,403 F229V probably damaging Het
Muc2 G A 7: 141,696,300 probably null Het
Myh10 A G 11: 68,785,909 T906A probably benign Het
Myh13 A G 11: 67,327,230 D43G probably benign Het
Nacad C T 11: 6,599,071 D1327N probably benign Het
Nbeal1 A T 1: 60,291,889 Y2219F probably damaging Het
Nckap5 A G 1: 126,025,426 S1130P probably benign Het
Pfkfb3 T C 2: 11,481,908 N415S probably benign Het
Plxdc2 A G 2: 16,660,867 I293V possibly damaging Het
Prpf38a A T 4: 108,579,080 I12N probably damaging Het
Qars A G 9: 108,509,471 D161G probably damaging Het
Scaf8 T A 17: 3,197,274 D957E probably damaging Het
Scn7a T C 2: 66,676,345 Y1400C probably damaging Het
Sis T C 3: 72,925,468 I999V probably benign Het
Sorcs2 A T 5: 36,024,614 L1054H probably damaging Het
Sptbn1 C T 11: 30,138,455 A906T probably damaging Het
Srd5a2 A G 17: 74,024,546 F152S probably benign Het
Stkld1 T A 2: 26,945,876 L241* probably null Het
Strip2 A T 6: 29,923,913 probably null Het
Tcaf1 A C 6: 42,673,429 Y905* probably null Het
Tet2 T C 3: 133,473,643 I1254V probably benign Het
Tiam2 A T 17: 3,437,247 N681I probably damaging Het
Trappc6a A G 7: 19,514,199 probably null Het
Trav12-2 A T 14: 53,616,766 K66* probably null Het
Ttn T A 2: 76,767,497 I19691F probably damaging Het
Tubgcp5 A T 7: 55,800,696 Q185L possibly damaging Het
Vmn1r44 A T 6: 89,892,210 probably benign Het
Vps13a T C 19: 16,651,456 D2717G possibly damaging Het
Vps13d A T 4: 145,178,063 Y133* probably null Het
Zer1 T C 2: 30,110,373 D265G probably damaging Het
Zfp710 A G 7: 80,081,111 D12G possibly damaging Het
Zfp819 T C 7: 43,616,767 S225P probably benign Het
Other mutations in Ptprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ptprt APN 2 161810624 missense probably benign 0.00
IGL00565:Ptprt APN 2 161560191 missense probably damaging 1.00
IGL00925:Ptprt APN 2 161656163 missense possibly damaging 0.52
IGL01344:Ptprt APN 2 161551817 missense probably damaging 1.00
IGL01432:Ptprt APN 2 162268079 splice site probably benign
IGL02008:Ptprt APN 2 161927673 missense probably benign 0.02
IGL02040:Ptprt APN 2 162238072 missense probably damaging 1.00
IGL02172:Ptprt APN 2 161555502 missense probably damaging 1.00
IGL02231:Ptprt APN 2 162238060 missense probably damaging 1.00
IGL02231:Ptprt APN 2 162278046 critical splice donor site probably null
IGL02232:Ptprt APN 2 161530517 missense probably damaging 0.96
IGL02277:Ptprt APN 2 161547381 missense probably damaging 1.00
IGL02447:Ptprt APN 2 162278107 missense probably benign 0.01
IGL02601:Ptprt APN 2 161766307 missense probably benign 0.10
IGL02623:Ptprt APN 2 161607452 splice site probably benign
IGL03379:Ptprt APN 2 161555459 nonsense probably null
Poverina UTSW 2 161901497 missense possibly damaging 0.70
IGL03055:Ptprt UTSW 2 161533613 missense probably damaging 0.96
R0064:Ptprt UTSW 2 161927791 splice site probably benign
R0129:Ptprt UTSW 2 162278070 missense probably benign 0.35
R0131:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0131:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0132:Ptprt UTSW 2 162278110 missense probably benign 0.00
R0316:Ptprt UTSW 2 161607319 missense probably damaging 1.00
R0454:Ptprt UTSW 2 161553822 missense probably damaging 0.96
R0488:Ptprt UTSW 2 161553825 missense probably damaging 0.99
R0573:Ptprt UTSW 2 161551748 missense probably damaging 1.00
R0614:Ptprt UTSW 2 161812120 missense possibly damaging 0.59
R0834:Ptprt UTSW 2 161812139 splice site probably null
R1023:Ptprt UTSW 2 161558943 missense probably damaging 1.00
R1184:Ptprt UTSW 2 161927772 missense possibly damaging 0.82
R1253:Ptprt UTSW 2 162278226 missense probably damaging 1.00
R1476:Ptprt UTSW 2 161927484 missense probably damaging 1.00
R1515:Ptprt UTSW 2 162238034 missense probably damaging 1.00
R1595:Ptprt UTSW 2 161810549 critical splice donor site probably null
R1939:Ptprt UTSW 2 161927640 missense probably benign 0.45
R1987:Ptprt UTSW 2 161558898 missense probably damaging 1.00
R1987:Ptprt UTSW 2 161766321 missense possibly damaging 0.48
R2049:Ptprt UTSW 2 161534545 missense probably damaging 1.00
R2140:Ptprt UTSW 2 161811988 missense probably damaging 1.00
R2421:Ptprt UTSW 2 162278040 splice site probably benign
R3432:Ptprt UTSW 2 161927529 missense probably damaging 1.00
R3619:Ptprt UTSW 2 161566157 missense probably damaging 1.00
R3757:Ptprt UTSW 2 161812030 missense probably damaging 1.00
R3758:Ptprt UTSW 2 161812030 missense probably damaging 1.00
R3834:Ptprt UTSW 2 161547387 missense probably damaging 1.00
R3835:Ptprt UTSW 2 161547387 missense probably damaging 1.00
R3915:Ptprt UTSW 2 161555555 splice site probably benign
R4003:Ptprt UTSW 2 161566117 splice site probably benign
R4387:Ptprt UTSW 2 161927650 missense probably damaging 1.00
R4519:Ptprt UTSW 2 161564689 missense probably damaging 1.00
R4618:Ptprt UTSW 2 161553845 missense probably damaging 1.00
R4677:Ptprt UTSW 2 161901446 critical splice donor site probably null
R4866:Ptprt UTSW 2 161560239 missense probably damaging 1.00
R5088:Ptprt UTSW 2 162238175 missense probably benign 0.01
R5173:Ptprt UTSW 2 161927756 missense probably benign 0.01
R5215:Ptprt UTSW 2 162278164 missense probably damaging 1.00
R5383:Ptprt UTSW 2 161698049 missense probably damaging 1.00
R5398:Ptprt UTSW 2 161927592 missense probably damaging 1.00
R5518:Ptprt UTSW 2 162278223 missense probably damaging 0.99
R5711:Ptprt UTSW 2 161810604 missense probably damaging 0.98
R5735:Ptprt UTSW 2 161534564 missense probably damaging 0.98
R5834:Ptprt UTSW 2 161560269 missense probably damaging 1.00
R5872:Ptprt UTSW 2 162135218 missense probably damaging 1.00
R5926:Ptprt UTSW 2 161564686 missense probably benign 0.00
R6210:Ptprt UTSW 2 162268029 missense probably damaging 1.00
R6285:Ptprt UTSW 2 161901497 missense possibly damaging 0.70
R6298:Ptprt UTSW 2 161553859 missense probably damaging 1.00
R6406:Ptprt UTSW 2 161553783 missense probably damaging 0.98
R6499:Ptprt UTSW 2 161534587 missense probably benign 0.32
R6613:Ptprt UTSW 2 161530447 missense probably damaging 1.00
R6622:Ptprt UTSW 2 161553840 missense probably damaging 1.00
R7218:Ptprt UTSW 2 161547364 missense probably damaging 1.00
R7247:Ptprt UTSW 2 161533523 missense probably benign 0.15
R7576:Ptprt UTSW 2 161607305 missense possibly damaging 0.88
R7733:Ptprt UTSW 2 161575787 missense probably damaging 1.00
R7735:Ptprt UTSW 2 161575741 missense probably damaging 1.00
R8031:Ptprt UTSW 2 162135457 missense probably damaging 1.00
R8074:Ptprt UTSW 2 161927661 missense possibly damaging 0.77
X0064:Ptprt UTSW 2 161927483 missense probably damaging 1.00
Z1088:Ptprt UTSW 2 162238121 missense possibly damaging 0.86
Z1177:Ptprt UTSW 2 161732887 missense probably damaging 1.00
Z1177:Ptprt UTSW 2 162362948 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- ATTGCCCTGCAGGAAAGAG -3'
(R):5'- GGCTCAGACTAAAGTTCGAATG -3'

Sequencing Primer
(F):5'- TTGCCCTGCAGGAAAGAGAAATTG -3'
(R):5'- GACTTCGACTCACCTGTT -3'
Posted On2019-11-26