Incidental Mutation 'R7813:C1rb'
ID601294
Institutional Source Beutler Lab
Gene Symbol C1rb
Ensembl Gene ENSMUSG00000098470
Gene Namecomplement component 1, r subcomponent B
SynonymsGm8551, mC1rB
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.859) question?
Stock #R7813 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location124570294-124581171 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 124580529 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 542 (I542F)
Ref Sequence ENSEMBL: ENSMUSP00000139376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000184647]
Predicted Effect probably benign
Transcript: ENSMUST00000184647
AA Change: I542F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000139376
Gene: ENSMUSG00000098470
AA Change: I542F

DomainStartEndE-ValueType
CUB 14 140 2.21e-35 SMART
EGF_CA 141 189 1.88e-10 SMART
CUB 192 304 4.74e-35 SMART
CCP 308 370 2.42e-9 SMART
CCP 375 446 1.53e-6 SMART
Tryp_SPc 462 698 5.36e-75 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik G A 10: 29,224,900 R423K probably benign Het
Acot7 T C 4: 152,223,118 S170P probably damaging Het
Arhgap40 A G 2: 158,538,700 Q341R probably benign Het
Arhgef28 T C 13: 97,945,681 E1206G possibly damaging Het
Arpp21 T A 9: 112,179,065 K122N probably damaging Het
Arsi T C 18: 60,916,654 L203P possibly damaging Het
Cadm3 C A 1: 173,344,389 V206L probably benign Het
Card11 T C 5: 140,899,664 D380G probably damaging Het
Ccdc42 A T 11: 68,597,708 Q164L probably benign Het
Ccnd1 A G 7: 144,937,885 probably null Het
Cep120 T C 18: 53,738,506 D98G probably damaging Het
Clca2 C A 3: 145,084,965 A449S probably benign Het
Dnah7a A G 1: 53,618,086 F844L probably benign Het
Fbxo11 T A 17: 88,000,817 I480F Het
Fcrl5 A G 3: 87,443,623 T147A probably benign Het
Gm15130 T A 2: 111,138,975 I133F Het
Gpr155 C T 2: 73,381,985 W98* probably null Het
Hspa4 A G 11: 53,272,036 S408P probably damaging Het
Il12rb2 G A 6: 67,356,651 R215C possibly damaging Het
Itga5 T A 15: 103,357,314 probably null Het
Krt12 A G 11: 99,418,483 probably null Het
March3 A T 18: 56,783,091 S177R probably benign Het
Minpp1 T G 19: 32,491,403 F229V probably damaging Het
Myh10 A G 11: 68,785,909 T906A probably benign Het
Myh13 A G 11: 67,327,230 D43G probably benign Het
Nacad C T 11: 6,599,071 D1327N probably benign Het
Nbeal1 A T 1: 60,291,889 Y2219F probably damaging Het
Nckap5 A G 1: 126,025,426 S1130P probably benign Het
Pfkfb3 T C 2: 11,481,908 N415S probably benign Het
Plxdc2 A G 2: 16,660,867 I293V possibly damaging Het
Prpf38a A T 4: 108,579,080 I12N probably damaging Het
Ptprt C T 2: 161,530,493 V1420M probably damaging Het
Qars A G 9: 108,509,471 D161G probably damaging Het
Scaf8 T A 17: 3,197,274 D957E probably damaging Het
Scn7a T C 2: 66,676,345 Y1400C probably damaging Het
Sis T C 3: 72,925,468 I999V probably benign Het
Sorcs2 A T 5: 36,024,614 L1054H probably damaging Het
Sptbn1 C T 11: 30,138,455 A906T probably damaging Het
Srd5a2 A G 17: 74,024,546 F152S probably benign Het
Stkld1 T A 2: 26,945,876 L241* probably null Het
Strip2 A T 6: 29,923,913 probably null Het
Tcaf1 A C 6: 42,673,429 Y905* probably null Het
Tet2 T C 3: 133,473,643 I1254V probably benign Het
Tiam2 A T 17: 3,437,247 N681I probably damaging Het
Trappc6a A G 7: 19,514,199 probably null Het
Trav12-2 A T 14: 53,616,766 K66* probably null Het
Ttn T A 2: 76,767,497 I19691F probably damaging Het
Tubgcp5 A T 7: 55,800,696 Q185L possibly damaging Het
Vmn1r44 A T 6: 89,892,210 probably benign Het
Vps13a T C 19: 16,651,456 D2717G possibly damaging Het
Vps13d A T 4: 145,178,063 Y133* probably null Het
Zer1 T C 2: 30,110,373 D265G probably damaging Het
Zfp710 A G 7: 80,081,111 D12G possibly damaging Het
Zfp819 T C 7: 43,616,767 S225P probably benign Het
Other mutations in C1rb
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3722:C1rb UTSW 6 124580661 missense probably damaging 1.00
R4806:C1rb UTSW 6 124574949 missense probably benign 0.18
R5095:C1rb UTSW 6 124580313 missense possibly damaging 0.91
R5572:C1rb UTSW 6 124580799 missense probably benign
R6223:C1rb UTSW 6 124574580 missense probably benign 0.06
R6769:C1rb UTSW 6 124577405 missense probably benign 0.00
R6771:C1rb UTSW 6 124577405 missense probably benign 0.00
R7204:C1rb UTSW 6 124577427 missense probably benign
R7335:C1rb UTSW 6 124575279 missense possibly damaging 0.87
R7341:C1rb UTSW 6 124577452 nonsense probably null
R7554:C1rb UTSW 6 124580406 missense probably damaging 1.00
R7604:C1rb UTSW 6 124580484 missense not run
R7753:C1rb UTSW 6 124580431 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACCACTATCTATGGGCCAGG -3'
(R):5'- CAGGCAGTCTGACAAACCTG -3'

Sequencing Primer
(F):5'- CTATCTATGGGCCAGGGGGTG -3'
(R):5'- CCTGAGATGGAAAGGTATCCTATTTC -3'
Posted On2019-11-26