Incidental Mutation 'R7813:Zfp819'
ID 601296
Institutional Source Beutler Lab
Gene Symbol Zfp819
Ensembl Gene ENSMUSG00000055102
Gene Name zinc finger protein 819
Synonyms 4933405K07Rik, 4930427I11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock # R7813 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 43607169-43618285 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43616767 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 225 (S225P)
Ref Sequence ENSEMBL: ENSMUSP00000032661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032661] [ENSMUST00000116324] [ENSMUST00000120935] [ENSMUST00000127765]
AlphaFold Q80V81
Predicted Effect probably benign
Transcript: ENSMUST00000032661
AA Change: S225P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032661
Gene: ENSMUSG00000055102
AA Change: S225P

DomainStartEndE-ValueType
KRAB 27 85 1.69e-21 SMART
ZnF_C2H2 300 327 5.4e1 SMART
ZnF_C2H2 356 378 3.74e-5 SMART
ZnF_C2H2 384 406 5.59e-4 SMART
ZnF_C2H2 412 434 1.36e-2 SMART
ZnF_C2H2 440 462 7.78e-3 SMART
ZnF_C2H2 468 490 5.9e-3 SMART
ZnF_C2H2 496 518 1.2e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 4.54e-4 SMART
ZnF_C2H2 580 602 3.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116324
AA Change: S225P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112026
Gene: ENSMUSG00000055102
AA Change: S225P

DomainStartEndE-ValueType
KRAB 27 85 1.69e-21 SMART
ZnF_C2H2 300 327 5.4e1 SMART
ZnF_C2H2 356 378 3.74e-5 SMART
ZnF_C2H2 384 406 5.59e-4 SMART
ZnF_C2H2 412 434 1.36e-2 SMART
ZnF_C2H2 440 462 7.78e-3 SMART
ZnF_C2H2 468 490 5.9e-3 SMART
ZnF_C2H2 496 518 1.2e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 4.54e-4 SMART
ZnF_C2H2 580 602 3.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120935
AA Change: S149P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113867
Gene: ENSMUSG00000055102
AA Change: S149P

DomainStartEndE-ValueType
ZnF_C2H2 224 251 5.4e1 SMART
ZnF_C2H2 280 302 3.74e-5 SMART
ZnF_C2H2 308 330 5.59e-4 SMART
ZnF_C2H2 336 358 1.36e-2 SMART
ZnF_C2H2 364 386 7.78e-3 SMART
ZnF_C2H2 392 414 5.9e-3 SMART
ZnF_C2H2 420 442 1.2e-3 SMART
ZnF_C2H2 448 470 4.79e-3 SMART
ZnF_C2H2 476 498 4.54e-4 SMART
ZnF_C2H2 504 526 3.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127765
SMART Domains Protein: ENSMUSP00000116658
Gene: ENSMUSG00000055102

DomainStartEndE-ValueType
KRAB 27 85 1.69e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik G A 10: 29,224,900 R423K probably benign Het
Acot7 T C 4: 152,223,118 S170P probably damaging Het
Arhgap40 A G 2: 158,538,700 Q341R probably benign Het
Arhgef28 T C 13: 97,945,681 E1206G possibly damaging Het
Arpp21 T A 9: 112,179,065 K122N probably damaging Het
Arsi T C 18: 60,916,654 L203P possibly damaging Het
C1rb A T 6: 124,580,529 I542F probably benign Het
Cadm3 C A 1: 173,344,389 V206L probably benign Het
Card11 T C 5: 140,899,664 D380G probably damaging Het
Ccdc42 A T 11: 68,597,708 Q164L probably benign Het
Ccnd1 A G 7: 144,937,885 probably null Het
Cep120 T C 18: 53,738,506 D98G probably damaging Het
Chrd A G 16: 20,735,405 T336A probably benign Het
Clca2 C A 3: 145,084,965 A449S probably benign Het
Dnah7a A G 1: 53,618,086 F844L probably benign Het
Fbxo11 T A 17: 88,000,817 I480F Het
Fcrl5 A G 3: 87,443,623 T147A probably benign Het
Gm15130 T A 2: 111,138,975 I133F Het
Gpr155 C T 2: 73,381,985 W98* probably null Het
Hspa4 A G 11: 53,272,036 S408P probably damaging Het
Il12rb2 G A 6: 67,356,651 R215C possibly damaging Het
Itga5 T A 15: 103,357,314 probably null Het
Kcnip3 T A 2: 127,481,783 probably null Het
Krt12 A G 11: 99,418,483 probably null Het
March3 A T 18: 56,783,091 S177R probably benign Het
Minpp1 T G 19: 32,491,403 F229V probably damaging Het
Muc2 G A 7: 141,696,300 probably null Het
Myh10 A G 11: 68,785,909 T906A probably benign Het
Myh13 A G 11: 67,327,230 D43G probably benign Het
Nacad C T 11: 6,599,071 D1327N probably benign Het
Nbeal1 A T 1: 60,291,889 Y2219F probably damaging Het
Nckap5 A G 1: 126,025,426 S1130P probably benign Het
Pfkfb3 T C 2: 11,481,908 N415S probably benign Het
Plxdc2 A G 2: 16,660,867 I293V possibly damaging Het
Prpf38a A T 4: 108,579,080 I12N probably damaging Het
Ptprt C T 2: 161,530,493 V1420M probably damaging Het
Qars A G 9: 108,509,471 D161G probably damaging Het
Scaf8 T A 17: 3,197,274 D957E probably damaging Het
Scn7a T C 2: 66,676,345 Y1400C probably damaging Het
Sis T C 3: 72,925,468 I999V probably benign Het
Sorcs2 A T 5: 36,024,614 L1054H probably damaging Het
Sptbn1 C T 11: 30,138,455 A906T probably damaging Het
Srd5a2 A G 17: 74,024,546 F152S probably benign Het
Stkld1 T A 2: 26,945,876 L241* probably null Het
Strip2 A T 6: 29,923,913 probably null Het
Tcaf1 A C 6: 42,673,429 Y905* probably null Het
Tet2 T C 3: 133,473,643 I1254V probably benign Het
Tiam2 A T 17: 3,437,247 N681I probably damaging Het
Trappc6a A G 7: 19,514,199 probably null Het
Trav12-2 A T 14: 53,616,766 K66* probably null Het
Ttn T A 2: 76,767,497 I19691F probably damaging Het
Tubgcp5 A T 7: 55,800,696 Q185L possibly damaging Het
Vmn1r44 A T 6: 89,892,210 probably benign Het
Vps13a T C 19: 16,651,456 D2717G possibly damaging Het
Vps13d A T 4: 145,178,063 Y133* probably null Het
Zer1 T C 2: 30,110,373 D265G probably damaging Het
Zfp710 A G 7: 80,081,111 D12G possibly damaging Het
Other mutations in Zfp819
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Zfp819 APN 7 43611979 splice site probably benign
IGL01732:Zfp819 APN 7 43616422 missense probably benign 0.13
IGL02139:Zfp819 APN 7 43612110 critical splice donor site probably null
IGL02276:Zfp819 APN 7 43612004 missense possibly damaging 0.84
R0306:Zfp819 UTSW 7 43617197 missense possibly damaging 0.92
R0620:Zfp819 UTSW 7 43616444 missense probably benign 0.07
R1301:Zfp819 UTSW 7 43617100 missense possibly damaging 0.94
R1314:Zfp819 UTSW 7 43617056 missense probably benign 0.27
R1980:Zfp819 UTSW 7 43616461 missense probably benign
R4545:Zfp819 UTSW 7 43617785 missense probably damaging 0.98
R4993:Zfp819 UTSW 7 43617296 missense probably benign 0.37
R5053:Zfp819 UTSW 7 43617146 missense probably damaging 1.00
R6080:Zfp819 UTSW 7 43616696 missense probably benign 0.00
R7289:Zfp819 UTSW 7 43617082 missense probably damaging 1.00
R7387:Zfp819 UTSW 7 43612641 critical splice donor site probably null
R7608:Zfp819 UTSW 7 43616933 missense probably benign
R7863:Zfp819 UTSW 7 43617892 missense probably benign 0.17
R8026:Zfp819 UTSW 7 43617895 missense probably benign 0.44
R8080:Zfp819 UTSW 7 43617724 missense probably damaging 1.00
R9072:Zfp819 UTSW 7 43617146 missense probably damaging 1.00
R9073:Zfp819 UTSW 7 43617146 missense probably damaging 1.00
R9199:Zfp819 UTSW 7 43617779 missense probably benign 0.04
Z1176:Zfp819 UTSW 7 43617687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTCTTCAGCCAGAAAACAC -3'
(R):5'- TGCTGACACAAAGCTGACCC -3'

Sequencing Primer
(F):5'- ACACTAATCACAGATGGACGTG -3'
(R):5'- CGGCAGTGAAGACCTTCTC -3'
Posted On 2019-11-26