Incidental Mutation 'R7813:Ccdc42'
ID601307
Institutional Source Beutler Lab
Gene Symbol Ccdc42
Ensembl Gene ENSMUSG00000045915
Gene Namecoiled-coil domain containing 42
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R7813 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location68587021-68597966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 68597708 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 164 (Q164L)
Ref Sequence ENSEMBL: ENSMUSP00000099672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063006] [ENSMUST00000102612] [ENSMUST00000154294]
Predicted Effect probably benign
Transcript: ENSMUST00000063006
AA Change: Q233L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000057342
Gene: ENSMUSG00000045915
AA Change: Q233L

DomainStartEndE-ValueType
Pfam:DUF4200 39 169 6e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102612
AA Change: Q164L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099672
Gene: ENSMUSG00000045915
AA Change: Q164L

DomainStartEndE-ValueType
coiled coil region 35 92 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154294
AA Change: Q311L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114381
Gene: ENSMUSG00000045915
AA Change: Q311L

DomainStartEndE-ValueType
Pfam:DUF4200 44 162 5.6e-30 PFAM
coiled coil region 182 239 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no overt behavioral deficits. Males exhibit defects in the number and location of the sperm head-tail coupling apparatus, lack flagellated sperm, and are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik G A 10: 29,224,900 R423K probably benign Het
Acot7 T C 4: 152,223,118 S170P probably damaging Het
Arhgap40 A G 2: 158,538,700 Q341R probably benign Het
Arhgef28 T C 13: 97,945,681 E1206G possibly damaging Het
Arpp21 T A 9: 112,179,065 K122N probably damaging Het
Arsi T C 18: 60,916,654 L203P possibly damaging Het
C1rb A T 6: 124,580,529 I542F probably benign Het
Cadm3 C A 1: 173,344,389 V206L probably benign Het
Card11 T C 5: 140,899,664 D380G probably damaging Het
Ccnd1 A G 7: 144,937,885 probably null Het
Cep120 T C 18: 53,738,506 D98G probably damaging Het
Chrd A G 16: 20,735,405 T336A probably benign Het
Clca2 C A 3: 145,084,965 A449S probably benign Het
Dnah7a A G 1: 53,618,086 F844L probably benign Het
Fbxo11 T A 17: 88,000,817 I480F Het
Fcrl5 A G 3: 87,443,623 T147A probably benign Het
Gm15130 T A 2: 111,138,975 I133F Het
Gpr155 C T 2: 73,381,985 W98* probably null Het
Hspa4 A G 11: 53,272,036 S408P probably damaging Het
Il12rb2 G A 6: 67,356,651 R215C possibly damaging Het
Itga5 T A 15: 103,357,314 probably null Het
Kcnip3 T A 2: 127,481,783 probably null Het
Krt12 A G 11: 99,418,483 probably null Het
March3 A T 18: 56,783,091 S177R probably benign Het
Minpp1 T G 19: 32,491,403 F229V probably damaging Het
Muc2 G A 7: 141,696,300 probably null Het
Myh10 A G 11: 68,785,909 T906A probably benign Het
Myh13 A G 11: 67,327,230 D43G probably benign Het
Nacad C T 11: 6,599,071 D1327N probably benign Het
Nbeal1 A T 1: 60,291,889 Y2219F probably damaging Het
Nckap5 A G 1: 126,025,426 S1130P probably benign Het
Pfkfb3 T C 2: 11,481,908 N415S probably benign Het
Plxdc2 A G 2: 16,660,867 I293V possibly damaging Het
Prpf38a A T 4: 108,579,080 I12N probably damaging Het
Ptprt C T 2: 161,530,493 V1420M probably damaging Het
Qars A G 9: 108,509,471 D161G probably damaging Het
Scaf8 T A 17: 3,197,274 D957E probably damaging Het
Scn7a T C 2: 66,676,345 Y1400C probably damaging Het
Sis T C 3: 72,925,468 I999V probably benign Het
Sorcs2 A T 5: 36,024,614 L1054H probably damaging Het
Sptbn1 C T 11: 30,138,455 A906T probably damaging Het
Srd5a2 A G 17: 74,024,546 F152S probably benign Het
Stkld1 T A 2: 26,945,876 L241* probably null Het
Strip2 A T 6: 29,923,913 probably null Het
Tcaf1 A C 6: 42,673,429 Y905* probably null Het
Tet2 T C 3: 133,473,643 I1254V probably benign Het
Tiam2 A T 17: 3,437,247 N681I probably damaging Het
Trappc6a A G 7: 19,514,199 probably null Het
Trav12-2 A T 14: 53,616,766 K66* probably null Het
Ttn T A 2: 76,767,497 I19691F probably damaging Het
Tubgcp5 A T 7: 55,800,696 Q185L possibly damaging Het
Vmn1r44 A T 6: 89,892,210 probably benign Het
Vps13a T C 19: 16,651,456 D2717G possibly damaging Het
Vps13d A T 4: 145,178,063 Y133* probably null Het
Zer1 T C 2: 30,110,373 D265G probably damaging Het
Zfp710 A G 7: 80,081,111 D12G possibly damaging Het
Zfp819 T C 7: 43,616,767 S225P probably benign Het
Other mutations in Ccdc42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Ccdc42 APN 11 68594621 missense probably benign 0.09
IGL01897:Ccdc42 APN 11 68594275 missense probably benign 0.00
R0153:Ccdc42 UTSW 11 68587650 missense possibly damaging 0.56
R0540:Ccdc42 UTSW 11 68597710 nonsense probably null
R0607:Ccdc42 UTSW 11 68597710 nonsense probably null
R1619:Ccdc42 UTSW 11 68594289 missense probably damaging 0.97
R1831:Ccdc42 UTSW 11 68590979 missense probably benign 0.00
R2264:Ccdc42 UTSW 11 68587651 missense probably benign 0.03
R6307:Ccdc42 UTSW 11 68588280 missense probably damaging 1.00
R6352:Ccdc42 UTSW 11 68594365 missense probably damaging 1.00
R6522:Ccdc42 UTSW 11 68588220 missense probably damaging 1.00
R7009:Ccdc42 UTSW 11 68594616 missense probably damaging 0.99
R7262:Ccdc42 UTSW 11 68594573 missense probably damaging 1.00
R7827:Ccdc42 UTSW 11 68594196 missense probably benign 0.23
R8246:Ccdc42 UTSW 11 68587296 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCAGCCTCTGGAAGTCAAG -3'
(R):5'- GGAGAAGTAATTTCAGAGCCAACTTC -3'

Sequencing Primer
(F):5'- GGATGAGGGCAATGAGGTCCTTC -3'
(R):5'- GGAACCTTCTCTTTCCTAGG -3'
Posted On2019-11-26