Incidental Mutation 'R7814:Polr1b'
ID601334
Institutional Source Beutler Lab
Gene Symbol Polr1b
Ensembl Gene ENSMUSG00000027395
Gene Namepolymerase (RNA) I polypeptide B
Synonyms128kDa, RPA116, RPA2, D630020H17Rik, Rpo1-2
Accession Numbers

Ncbi RefSeq: NM_009086.2; MGI:108014

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7814 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location129100995-129126594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 129125544 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 952 (F952L)
Ref Sequence ENSEMBL: ENSMUSP00000099494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028874] [ENSMUST00000035481] [ENSMUST00000103205]
Predicted Effect probably benign
Transcript: ENSMUST00000028874
SMART Domains Protein: ENSMUSP00000028874
Gene: ENSMUSG00000027395

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 37 437 4.6e-35 PFAM
Pfam:RNA_pol_Rpb2_2 186 375 8.9e-14 PFAM
Pfam:RNA_pol_Rpb2_3 455 521 1.4e-28 PFAM
Pfam:RNA_pol_Rpa2_4 563 621 3.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000035481
SMART Domains Protein: ENSMUSP00000044253
Gene: ENSMUSG00000037938

DomainStartEndE-ValueType
PDB:2LQL|A 1 110 2e-69 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000103205
AA Change: F952L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099494
Gene: ENSMUSG00000027395
AA Change: F952L

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 37 423 1.7e-35 PFAM
Pfam:RNA_pol_Rpb2_2 186 375 3.2e-11 PFAM
Pfam:RNA_pol_Rpb2_3 455 520 2.1e-29 PFAM
Pfam:RNA_pol_Rpa2_4 563 621 4.1e-23 PFAM
Pfam:RNA_pol_Rpb2_6 670 1031 9.7e-118 PFAM
Pfam:RNA_pol_Rpb2_7 1033 1135 1.2e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype Strain: 3774130
Lethality: E2-E4
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic RNA polymerase I (pol I) is responsible for the transcription of ribosomal RNA (rRNA) genes and production of rRNA, the primary component of ribosomes. Pol I is a multisubunit enzyme composed of 6 to 14 polypeptides, depending on the species. Most of the mass of the pol I complex derives from the 2 largest subunits, Rpa1 and Rpa2 in yeast. POLR1B is homologous to Rpa2 (Seither and Grummt, 1996 [PubMed 8921381]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality prior to implantation. [provided by MGI curators]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110065P20Rik C T 4: 124,850,602 G20R not run Het
4931409K22Rik G T 5: 24,545,422 Q626K possibly damaging Het
Adamts13 A T 2: 26,996,549 M927L probably benign Het
Akap6 T A 12: 53,140,961 N1719K probably benign Het
Ank3 G A 10: 69,986,904 V468M Het
Aox1 A G 1: 58,085,467 T956A probably benign Het
Ap4m1 T C 5: 138,174,817 V140A probably benign Het
Apc A G 18: 34,272,539 T173A probably damaging Het
Bclaf1 A G 10: 20,334,619 T839A possibly damaging Het
Btn2a2 T A 13: 23,482,806 I210F possibly damaging Het
Cadps A G 14: 12,376,706 W1269R probably damaging Het
Capn2 G C 1: 182,492,146 P159R probably damaging Het
Ccdc134 T G 15: 82,131,523 V68G probably damaging Het
Cdh26 A G 2: 178,470,035 T463A probably damaging Het
Cfap206 C T 4: 34,716,347 V373I probably benign Het
Clpx T C 9: 65,324,301 probably null Het
Ctnnd2 A T 15: 31,020,728 Y1145F probably benign Het
Ctr9 T A 7: 111,033,927 D127E probably benign Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Cyp7b1 G A 3: 18,097,302 S249L probably benign Het
D630023F18Rik T A 1: 65,116,691 D125V possibly damaging Het
Dbh A T 2: 27,174,848 Y357F probably damaging Het
Dbp T A 7: 45,706,990 L175Q probably benign Het
Dmwd A T 7: 19,080,843 T473S probably benign Het
Dnah9 T A 11: 66,005,660 Q2446L probably damaging Het
Dnmbp T C 19: 43,854,176 K498R probably benign Het
Dopey2 T A 16: 93,799,971 I1924N probably damaging Het
Dzank1 T C 2: 144,522,564 T38A probably damaging Het
Egfem1 A G 3: 29,686,791 H538R probably damaging Het
Entpd1 T C 19: 40,727,447 C353R probably damaging Het
Ephx2 C A 14: 66,110,229 C78F probably benign Het
Faf2 A T 13: 54,660,961 H388L probably benign Het
Fam186a G A 15: 99,944,664 T1233I possibly damaging Het
Gfra2 C A 14: 70,895,970 A80E probably damaging Het
Gif C A 19: 11,750,187 P125Q probably benign Het
Gm17175 T A 14: 51,574,035 probably benign Het
Gm8180 T C 14: 43,783,646 D35G possibly damaging Het
Gm884 T A 11: 103,614,173 H2323L possibly damaging Het
Gpr68 C T 12: 100,879,043 V81M probably damaging Het
Hsd3b6 A G 3: 98,810,943 L35P probably damaging Het
Hspd1 A C 1: 55,078,644 V485G possibly damaging Het
Il16 A G 7: 83,670,140 V381A possibly damaging Het
Il17rd G A 14: 27,100,117 C600Y probably benign Het
Ins2 C A 7: 142,679,586 probably benign Het
Itsn2 T C 12: 4,658,561 I872T probably benign Het
Jakmip3 A T 7: 139,019,129 D219V probably damaging Het
Jph4 T C 14: 55,109,735 T452A probably damaging Het
Kazn T C 4: 142,210,170 E12G unknown Het
Kif20b A C 19: 34,950,955 S1206R possibly damaging Het
Lca5l A G 16: 96,162,557 probably null Het
Lgals2 A T 15: 78,851,333 S60R probably benign Het
Map10 A G 8: 125,671,611 E581G probably benign Het
Map2k7 G T 8: 4,243,744 R128L probably benign Het
Mapk8 G C 14: 33,410,877 S34* probably null Het
Mcat A G 15: 83,547,909 Y253H probably damaging Het
Mmp2 T C 8: 92,850,170 L607P probably benign Het
Ncor1 A T 11: 62,333,926 V836E probably damaging Het
Neb A G 2: 52,137,380 S7113P probably damaging Het
Nphp4 T C 4: 152,524,272 F446L possibly damaging Het
Nphp4 G T 4: 152,544,403 D749Y probably damaging Het
Olfr115 T A 17: 37,610,656 T32S probably benign Het
Olfr1185-ps1 A G 2: 88,499,072 probably benign Het
Olfr175-ps1 T C 16: 58,824,002 K236E probably damaging Het
Olfr338 T C 2: 36,376,809 I11T possibly damaging Het
Osbpl11 A T 16: 33,210,061 R220* probably null Het
Plrg1 G A 3: 83,056,837 V26M probably damaging Het
Ppfia3 A C 7: 45,352,262 S560A probably benign Het
Ppp3cc T A 14: 70,225,015 N391I possibly damaging Het
Prdx6b T C 2: 80,292,960 S38P possibly damaging Het
Psg23 A T 7: 18,606,914 *472R probably null Het
Rapgef4 A T 2: 72,223,117 M587L probably benign Het
Rfx3 T A 19: 27,826,070 M247L probably benign Het
Rgs7 T A 1: 175,076,069 H463L probably benign Het
Riiad1 G T 3: 94,465,855 S106R probably benign Het
Rims4 A C 2: 163,918,628 I19S probably benign Het
Ros1 A T 10: 52,096,137 M1648K probably benign Het
Rrn3 T C 16: 13,811,589 F590L probably benign Het
Samd9l T A 6: 3,374,793 T823S possibly damaging Het
Sfxn1 C A 13: 54,091,231 P115Q possibly damaging Het
Slc10a7 T C 8: 78,698,573 probably null Het
Slc25a16 A T 10: 62,937,420 M142L probably benign Het
Srd5a1 ACTCCATGCTTACCCCTGGGTATTTTGTATCCAGTTTCCCTCCATGCTTACCCCTGGGTATTTTGTATCCAGTTTCCCTCCATGCTTACCCCTGGGTATTTTGTATCCAGTTTCCCTCCATGCTTACCCCTGGGTATTTTGTATCCAGTTTCCC ACTCCATGCTTACCCCTGGGTATTTTGTATCCAGTTTCCCTCCATGCTTACCCCTGGGTATTTTGTATCCAGTTTCCCTCCATGCTTACCCCTGGGTATTTTGTATCCAGTTTCCC 13: 69,594,789 probably benign Het
Stat2 CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC 10: 128,290,728 probably benign Het
Stat5a T G 11: 100,875,027 L313R probably damaging Het
Strap A G 6: 137,741,978 E176G possibly damaging Het
Tlr4 T G 4: 66,841,079 L703R probably damaging Het
Trim36 A T 18: 46,167,624 V660D possibly damaging Het
Tspoap1 T A 11: 87,775,524 D980E probably damaging Het
Usp28 T C 9: 49,003,918 V157A probably benign Het
Vmn2r17 A T 5: 109,427,873 R203S probably benign Het
Vmn2r66 T C 7: 85,007,264 I181M probably benign Het
Zan T A 5: 137,463,579 T1113S unknown Het
Zfp442 C T 2: 150,409,482 D167N possibly damaging Het
Other mutations in Polr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Polr1b APN 2 129125909 missense probably damaging 1.00
IGL00559:Polr1b APN 2 129113731 missense probably damaging 1.00
IGL00659:Polr1b APN 2 129118100 critical splice donor site probably null
IGL00672:Polr1b APN 2 129125472 missense probably damaging 1.00
IGL01066:Polr1b APN 2 129119152 missense probably damaging 1.00
IGL01536:Polr1b APN 2 129125555 missense probably benign 0.00
IGL01596:Polr1b APN 2 129110126 missense probably benign 0.38
IGL02156:Polr1b APN 2 129123879 missense probably benign 0.40
IGL02398:Polr1b APN 2 129102966 missense probably benign 0.03
IGL02797:Polr1b APN 2 129102979 missense probably damaging 0.99
IGL02965:Polr1b APN 2 129125523 missense probably benign 0.41
IGL03009:Polr1b APN 2 129126068 missense probably damaging 1.00
IGL03092:Polr1b APN 2 129123129 missense probably damaging 1.00
IGL03129:Polr1b APN 2 129115707 missense probably benign 0.00
IGL03138:Polr1b UTSW 2 129102988 missense probably benign 0.04
PIT4362001:Polr1b UTSW 2 129109292 missense possibly damaging 0.84
R0038:Polr1b UTSW 2 129115668 nonsense probably null
R0038:Polr1b UTSW 2 129115668 nonsense probably null
R0989:Polr1b UTSW 2 129126077 missense probably damaging 0.97
R1508:Polr1b UTSW 2 129113734 missense probably benign 0.24
R1539:Polr1b UTSW 2 129118099 critical splice donor site probably null
R1700:Polr1b UTSW 2 129123121 missense probably damaging 0.99
R1843:Polr1b UTSW 2 129102966 missense probably benign 0.03
R1920:Polr1b UTSW 2 129101111 missense probably benign 0.00
R2414:Polr1b UTSW 2 129103134 splice site probably benign
R3020:Polr1b UTSW 2 129115681 missense probably benign 0.01
R3837:Polr1b UTSW 2 129119107 missense possibly damaging 0.78
R4466:Polr1b UTSW 2 129123882 missense probably benign 0.03
R4773:Polr1b UTSW 2 129105328 missense probably benign 0.29
R4789:Polr1b UTSW 2 129109337 missense probably benign 0.00
R5027:Polr1b UTSW 2 129123883 missense possibly damaging 0.94
R5579:Polr1b UTSW 2 129110108 missense probably damaging 1.00
R5705:Polr1b UTSW 2 129105351 nonsense probably null
R6303:Polr1b UTSW 2 129115762 missense probably damaging 1.00
R6313:Polr1b UTSW 2 129125446 missense probably damaging 1.00
R6427:Polr1b UTSW 2 129123261 missense probably damaging 0.99
R6677:Polr1b UTSW 2 129120211 intron probably benign
R7033:Polr1b UTSW 2 129115642 missense possibly damaging 0.82
R7163:Polr1b UTSW 2 129126011 missense probably benign 0.44
R7184:Polr1b UTSW 2 129123922 missense possibly damaging 0.94
R7376:Polr1b UTSW 2 129119073 missense probably benign 0.00
R7453:Polr1b UTSW 2 129125663 missense probably damaging 1.00
R7545:Polr1b UTSW 2 129117846 intron probably null
R7770:Polr1b UTSW 2 129125544 missense probably damaging 1.00
R7772:Polr1b UTSW 2 129125544 missense probably damaging 1.00
R7774:Polr1b UTSW 2 129125544 missense probably damaging 1.00
R7776:Polr1b UTSW 2 129125544 missense probably damaging 1.00
R7777:Polr1b UTSW 2 129125544 missense probably damaging 1.00
R7825:Polr1b UTSW 2 129125544 missense probably damaging 1.00
R7826:Polr1b UTSW 2 129125544 missense probably damaging 1.00
R7827:Polr1b UTSW 2 129125544 missense probably damaging 1.00
R7828:Polr1b UTSW 2 129105280 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTTGCCAGCCGACATGG -3'
(R):5'- CTGGCTCCAGTTGTTCTGAC -3'

Sequencing Primer
(F):5'- CGACATGGTCAGAAGGGCATTTTG -3'
(R):5'- CTGACTTGAAATTTGTCTGACACC -3'
Posted On2019-11-26