Mutagenetix > Incidental Mutation

Incidental Mutation 'R7814:Tlr4'

601345

Institutional Source

Beutler Lab

Gene Symbol

Tlr4

Ensembl Gene

ENSMUSG00000039005

Gene Name

toll-like receptor 4

Synonyms

Rasl2-8, Lps, lipopolysaccharide response

MMRRC Submission

Accession Numbers

MGI: 96824

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7814 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

66827584-66930284 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 66841079 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 703 (L703R)

Ref Sequence

ENSEMBL: ENSMUSP00000045770 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048096] [ENSMUST00000107365]

AlphaFold

Q9QUK6

PDB Structure

Crystal structure of mouse TLR4 and mouse MD-2 complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/lipid IVa complex [X-RAY DIFFRACTION]
Crystal structure of mouse TLR4/MD-2/LPS complex [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000048096
AA Change: L703R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000045770
Gene: ENSMUSG00000039005
AA Change: L703R

Domain	Start	End	E-Value	Type
LRR	76	99	7.36e0	SMART
LRR	100	123	1.86e0	SMART
LRR	173	196	8.24e0	SMART
LRR	370	401	4.33e1	SMART
LRR	468	492	2.54e2	SMART
LRR	493	516	1.86e2	SMART
LRR	517	540	1.67e2	SMART
LRR	541	563	1.92e2	SMART
LRRCT	576	626	4.74e-3	SMART
transmembrane domain	636	658	N/A	INTRINSIC
TIR	671	816	7.3e-39	SMART
low complexity region	822	833	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107365

SMART Domains

Protein: ENSMUSP00000102988
Gene: ENSMUSG00000039005

Domain	Start	End	E-Value	Type
PDB:3VQ2\|B	22	86	2e-38	PDB
SCOP:d1m0za_	27	86	4e-6	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (90/90)

MGI Phenotype

FUNCTION: This gene belongs to the evolutionarily-conserved Toll-like receptor family, whose members are type-1 transmembrane proteins that are involved in innate immunity. Toll-like receptors are characterized by an extracellular leucine-rich repeat domain that functions in ligand recognition and an intracellular toll/interleukin-1 receptor-like domain that is crucial for signal transduction. The receptor encoded by this gene mediates the innate immune response to bacterial lipopolysaccharide, a major component of the outer membrane of Gram-negative bacteria, through synthesis of pro-inflammatory cytokines and chemokines. In addition, this protein can recognize other pathogens from Gram-negative and Gram-positive bacteria as well as viral components. Mice deficient in this gene display a number of immune response-related phenotypes including hyporesponsiveness to bacterial lipopolysaccharide and increased levels of respiratory syncytial virus compared to controls. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for spontaneous or targeted mutations are hyporesponsive to bacterial lipopolysaccharide and more susceptible to infection by gram negative bacteria. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted(2) Spontaneous(6) Chemically induced(2)

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110065P20Rik	C	T	4: 124,850,602	G20R	not run	Het
4931409K22Rik	G	T	5: 24,545,422	Q626K	possibly damaging	Het
Adamts13	A	T	2: 26,996,549	M927L	probably benign	Het
Akap6	T	A	12: 53,140,961	N1719K	probably benign	Het
Ank3	G	A	10: 69,986,904	V468M		Het
Aox1	A	G	1: 58,085,467	T956A	probably benign	Het
Ap4m1	T	C	5: 138,174,817	V140A	probably benign	Het
Apc	A	G	18: 34,272,539	T173A	probably damaging	Het
Bclaf1	A	G	10: 20,334,619	T839A	possibly damaging	Het
Btn2a2	T	A	13: 23,482,806	I210F	possibly damaging	Het
Cadps	A	G	14: 12,376,706	W1269R	probably damaging	Het
Capn2	G	C	1: 182,492,146	P159R	probably damaging	Het
Ccdc134	T	G	15: 82,131,523	V68G	probably damaging	Het
Cdh26	A	G	2: 178,470,035	T463A	probably damaging	Het
Cfap206	C	T	4: 34,716,347	V373I	probably benign	Het
Clpx	T	C	9: 65,324,301		probably null	Het
Ctnnd2	A	T	15: 31,020,728	Y1145F	probably benign	Het
Ctr9	T	A	7: 111,033,927	D127E	probably benign	Het
Cyp2f2	G	A	7: 27,129,253	V183I	probably benign	Het
Cyp7b1	G	A	3: 18,097,302	S249L	probably benign	Het
D630023F18Rik	T	A	1: 65,116,691	D125V	possibly damaging	Het
Dbh	A	T	2: 27,174,848	Y357F	probably damaging	Het
Dbp	T	A	7: 45,706,990	L175Q	probably benign	Het
Dmwd	A	T	7: 19,080,843	T473S	probably benign	Het
Dnah9	T	A	11: 66,005,660	Q2446L	probably damaging	Het
Dnmbp	T	C	19: 43,854,176	K498R	probably benign	Het
Dopey2	T	A	16: 93,799,971	I1924N	probably damaging	Het
Dsg1a	T	A	18: 20,338,515		probably null	Het
Dzank1	T	C	2: 144,522,564	T38A	probably damaging	Het
Egfem1	A	G	3: 29,686,791	H538R	probably damaging	Het
Entpd1	T	C	19: 40,727,447	C353R	probably damaging	Het
Ephx2	C	A	14: 66,110,229	C78F	probably benign	Het
Faf2	A	T	13: 54,660,961	H388L	probably benign	Het
Fam186a	G	A	15: 99,944,664	T1233I	possibly damaging	Het
Gfra2	C	A	14: 70,895,970	A80E	probably damaging	Het
Gif	C	A	19: 11,750,187	P125Q	probably benign	Het
Gm17175	T	A	14: 51,574,035		probably benign	Het
Gm8180	T	C	14: 43,783,646	D35G	possibly damaging	Het
Gm884	T	A	11: 103,614,173	H2323L	possibly damaging	Het
Gpr68	C	T	12: 100,879,043	V81M	probably damaging	Het
Hsd3b6	A	G	3: 98,810,943	L35P	probably damaging	Het
Hspd1	A	C	1: 55,078,644	V485G	possibly damaging	Het
Il16	A	G	7: 83,670,140	V381A	possibly damaging	Het
Il17rd	G	A	14: 27,100,117	C600Y	probably benign	Het
Ins2	C	A	7: 142,679,586		probably benign	Het
Itsn2	T	C	12: 4,658,561	I872T	probably benign	Het
Jakmip3	A	T	7: 139,019,129	D219V	probably damaging	Het
Jph4	T	C	14: 55,109,735	T452A	probably damaging	Het
Kazn	T	C	4: 142,210,170	E12G	unknown	Het
Kif20b	A	C	19: 34,950,955	S1206R	possibly damaging	Het
Lca5l	A	G	16: 96,162,557		probably null	Het
Lgals2	A	T	15: 78,851,333	S60R	probably benign	Het
Map10	A	G	8: 125,671,611	E581G	probably benign	Het
Map2k7	G	T	8: 4,243,744	R128L	probably benign	Het
Mapk8	G	C	14: 33,410,877	S34*	probably null	Het
Mcat	A	G	15: 83,547,909	Y253H	probably damaging	Het
Mmp2	T	C	8: 92,850,170	L607P	probably benign	Het
Ncor1	A	T	11: 62,333,926	V836E	probably damaging	Het
Neb	A	G	2: 52,137,380	S7113P	probably damaging	Het
Nphp4	T	C	4: 152,524,272	F446L	possibly damaging	Het
Nphp4	G	T	4: 152,544,403	D749Y	probably damaging	Het
Olfr115	T	A	17: 37,610,656	T32S	probably benign	Het
Olfr1185-ps1	A	G	2: 88,499,072		probably benign	Het
Olfr175-ps1	T	C	16: 58,824,002	K236E	probably damaging	Het
Olfr338	T	C	2: 36,376,809	I11T	possibly damaging	Het
Osbpl11	A	T	16: 33,210,061	R220*	probably null	Het
Plrg1	G	A	3: 83,056,837	V26M	probably damaging	Het
Polr1b	C	A	2: 129,125,544	F952L	probably damaging	Het
Ppfia3	A	C	7: 45,352,262	S560A	probably benign	Het
Ppp3cc	T	A	14: 70,225,015	N391I	possibly damaging	Het
Prdx6b	T	C	2: 80,292,960	S38P	possibly damaging	Het
Psg23	A	T	7: 18,606,914	*472R	probably null	Het
Rapgef4	A	T	2: 72,223,117	M587L	probably benign	Het
Rfx3	T	A	19: 27,826,070	M247L	probably benign	Het
Rgs7	T	A	1: 175,076,069	H463L	probably benign	Het
Riiad1	G	T	3: 94,465,855	S106R	probably benign	Het
Rims4	A	C	2: 163,918,628	I19S	probably benign	Het
Ros1	A	T	10: 52,096,137	M1648K	probably benign	Het
Rrn3	T	C	16: 13,811,589	F590L	probably benign	Het
Samd9l	T	A	6: 3,374,793	T823S	possibly damaging	Het
Sfxn1	C	A	13: 54,091,231	P115Q	possibly damaging	Het
Slc10a7	T	C	8: 78,698,573		probably null	Het
Slc25a16	A	T	10: 62,937,420	M142L	probably benign	Het
Stat2	CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC	CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC	10: 128,290,728		probably benign	Het
Stat5a	T	G	11: 100,875,027	L313R	probably damaging	Het
Strap	A	G	6: 137,741,978	E176G	possibly damaging	Het
Trim36	A	T	18: 46,167,624	V660D	possibly damaging	Het
Tspoap1	T	A	11: 87,775,524	D980E	probably damaging	Het
Usp28	T	C	9: 49,003,918	V157A	probably benign	Het
Vmn2r17	A	T	5: 109,427,873	R203S	probably benign	Het
Vmn2r66	T	C	7: 85,007,264	I181M	probably benign	Het
Zan	T	A	5: 137,463,579	T1113S	unknown	Het
Zfp442	C	T	2: 150,409,482	D167N	possibly damaging	Het

Other mutations in Tlr4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01120:Tlr4	APN	4	66840425	missense	probably benign	0.01
IGL01343:Tlr4	APN	4	66833887	splice site	probably benign
IGL01669:Tlr4	APN	4	66841267	missense	possibly damaging	0.48
IGL01875:Tlr4	APN	4	66839489	missense	probably damaging	1.00
IGL02138:Tlr4	APN	4	66840965	missense	probably damaging	0.99
IGL02244:Tlr4	APN	4	66834061	critical splice donor site	probably null
IGL02793:Tlr4	APN	4	66839444	missense	probably damaging	1.00
IGL03269:Tlr4	APN	4	66840796	missense	probably damaging	1.00
IGL03288:Tlr4	APN	4	66839753	missense	probably damaging	0.99
bugsy	UTSW	4	66839254	nonsense	probably null
Cruyff	UTSW	4	66840326	missense	probably damaging	1.00
don_knotts	UTSW	4	66841172	missense	probably damaging	1.00
Guardiola	UTSW	4	66839303	missense	probably damaging	1.00
Lops	UTSW	4	66833880	splice site	probably null
lps3	UTSW	4	66841097	missense	probably damaging	1.00
Lps4	UTSW	4	66841142	missense	probably damaging	1.00
milquetoast	UTSW	4	66839444	missense	probably damaging	1.00
salvador	UTSW	4	66840206	missense	probably damaging	0.99
R0449:Tlr4	UTSW	4	66839620	missense	probably damaging	0.99
R0481:Tlr4	UTSW	4	66827916	missense	probably benign	0.05
R0576:Tlr4	UTSW	4	66839495	missense	probably benign	0.00
R0827:Tlr4	UTSW	4	66833880	splice site	probably null
R1488:Tlr4	UTSW	4	66839549	missense	probably damaging	1.00
R1490:Tlr4	UTSW	4	66839374	missense	possibly damaging	0.56
R1522:Tlr4	UTSW	4	66839696	missense	possibly damaging	0.80
R1616:Tlr4	UTSW	4	66839480	missense	probably damaging	1.00
R1681:Tlr4	UTSW	4	66841105	missense	probably damaging	1.00
R1738:Tlr4	UTSW	4	66841076	missense	probably benign	0.19
R1888:Tlr4	UTSW	4	66841172	missense	probably damaging	1.00
R1888:Tlr4	UTSW	4	66841172	missense	probably damaging	1.00
R1929:Tlr4	UTSW	4	66839444	missense	probably damaging	1.00
R1982:Tlr4	UTSW	4	66841035	missense	probably benign	0.40
R1998:Tlr4	UTSW	4	66840470	missense	probably damaging	1.00
R2186:Tlr4	UTSW	4	66839983	missense	possibly damaging	0.63
R2305:Tlr4	UTSW	4	66840101	missense	probably damaging	1.00
R3011:Tlr4	UTSW	4	66839254	nonsense	probably null
R3420:Tlr4	UTSW	4	66839536	missense	probably benign	0.37
R3422:Tlr4	UTSW	4	66839536	missense	probably benign	0.37
R3818:Tlr4	UTSW	4	66841316	missense	probably benign	0.00
R4212:Tlr4	UTSW	4	66840326	missense	probably damaging	1.00
R4213:Tlr4	UTSW	4	66840326	missense	probably damaging	1.00
R4417:Tlr4	UTSW	4	66839303	missense	probably damaging	1.00
R4630:Tlr4	UTSW	4	66839240	missense	probably benign	0.44
R4735:Tlr4	UTSW	4	66841198	missense	probably damaging	1.00
R5191:Tlr4	UTSW	4	66841379	missense	probably damaging	0.96
R5613:Tlr4	UTSW	4	66840885	missense	possibly damaging	0.94
R5705:Tlr4	UTSW	4	66833980	missense	probably damaging	1.00
R5726:Tlr4	UTSW	4	66840415	missense	probably benign
R6021:Tlr4	UTSW	4	66840866	missense	probably damaging	1.00
R6159:Tlr4	UTSW	4	66839833	missense	possibly damaging	0.92
R6227:Tlr4	UTSW	4	66840595	missense	probably benign
R7139:Tlr4	UTSW	4	66840283	missense	probably benign	0.06
R7199:Tlr4	UTSW	4	66841193	missense	probably damaging	0.99
R7220:Tlr4	UTSW	4	66839951	missense	probably benign
R7337:Tlr4	UTSW	4	66839954	missense	possibly damaging	0.86
R7487:Tlr4	UTSW	4	66924422	missense	probably benign	0.00
R7638:Tlr4	UTSW	4	66840206	missense	probably damaging	0.99
R7773:Tlr4	UTSW	4	66839599	missense	probably damaging	1.00
R7897:Tlr4	UTSW	4	66839821	missense	probably benign	0.07
R8044:Tlr4	UTSW	4	66827847	missense	probably benign	0.01
R8062:Tlr4	UTSW	4	66839850	missense	probably benign	0.00
R8080:Tlr4	UTSW	4	66839476	missense	probably damaging	1.00
R8446:Tlr4	UTSW	4	66839436	missense	probably damaging	0.98
R8916:Tlr4	UTSW	4	66929031	missense	probably benign	0.06
R9100:Tlr4	UTSW	4	66840281	missense	probably benign	0.08
R9415:Tlr4	UTSW	4	66827923	critical splice donor site	probably null
R9562:Tlr4	UTSW	4	66841285	missense	not run
R9565:Tlr4	UTSW	4	66841285	missense	not run
X0064:Tlr4	UTSW	4	66840140	missense	probably damaging	0.99
Z1088:Tlr4	UTSW	4	66929082	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGGTATCCACTGTAGCATTTCTG -3'
(R):5'- AGCAGGGACTTCTCAACCTTC -3'

Sequencing Primer
(F):5'- CACTGTAGCATTTCTGATATACCAC -3'
(R):5'- AGGGACTTCTCAACCTTCTCAAG -3'

Posted On

2019-11-26