Incidental Mutation 'R7814:Kazn'
ID601347
Institutional Source Beutler Lab
Gene Symbol Kazn
Ensembl Gene ENSMUSG00000040606
Gene Namekazrin, periplakin interacting protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R7814 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location142102390-142239401 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142210170 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 12 (E12G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036476] [ENSMUST00000129032]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036476
AA Change: E82G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038835
Gene: ENSMUSG00000040606
AA Change: E82G

DomainStartEndE-ValueType
low complexity region 68 88 N/A INTRINSIC
SCOP:d1eq1a_ 113 248 8e-3 SMART
low complexity region 368 375 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129032
SMART Domains Protein: ENSMUSP00000115897
Gene: ENSMUSG00000040606

DomainStartEndE-ValueType
coiled coil region 7 148 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000155023
AA Change: E12G
SMART Domains Protein: ENSMUSP00000116071
Gene: ENSMUSG00000040606
AA Change: E12G

DomainStartEndE-ValueType
coiled coil region 1 180 N/A INTRINSIC
low complexity region 299 306 N/A INTRINSIC
SAM 367 435 6.32e-6 SMART
SAM 444 512 4.17e-6 SMART
SAM 533 602 3.37e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000172864
AA Change: E12G
SMART Domains Protein: ENSMUSP00000133972
Gene: ENSMUSG00000040606
AA Change: E12G

DomainStartEndE-ValueType
coiled coil region 1 180 N/A INTRINSIC
low complexity region 299 306 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000174432
AA Change: E12G
SMART Domains Protein: ENSMUSP00000134631
Gene: ENSMUSG00000040606
AA Change: E12G

DomainStartEndE-ValueType
coiled coil region 1 180 N/A INTRINSIC
low complexity region 300 307 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays a role in desmosome assembly, cell adhesion, cytoskeletal organization, and epidermal differentiation. This protein co-localizes with desmoplakin and the cytolinker protein periplakin. In general, this protein localizes to the nucleus, desmosomes, cell membrane, and cortical actin-based structures. Some isoforms of this protein also associate with microtubules. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their biological validity has not been verified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable, fertile and grossly normal with no obvious defects in skin development or homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110065P20Rik C T 4: 124,850,602 G20R not run Het
4931409K22Rik G T 5: 24,545,422 Q626K possibly damaging Het
Adamts13 A T 2: 26,996,549 M927L probably benign Het
Akap6 T A 12: 53,140,961 N1719K probably benign Het
Ank3 G A 10: 69,986,904 V468M Het
Aox1 A G 1: 58,085,467 T956A probably benign Het
Ap4m1 T C 5: 138,174,817 V140A probably benign Het
Apc A G 18: 34,272,539 T173A probably damaging Het
Bclaf1 A G 10: 20,334,619 T839A possibly damaging Het
Btn2a2 T A 13: 23,482,806 I210F possibly damaging Het
Cadps A G 14: 12,376,706 W1269R probably damaging Het
Capn2 G C 1: 182,492,146 P159R probably damaging Het
Ccdc134 T G 15: 82,131,523 V68G probably damaging Het
Cdh26 A G 2: 178,470,035 T463A probably damaging Het
Cfap206 C T 4: 34,716,347 V373I probably benign Het
Clpx T C 9: 65,324,301 probably null Het
Ctnnd2 A T 15: 31,020,728 Y1145F probably benign Het
Ctr9 T A 7: 111,033,927 D127E probably benign Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Cyp7b1 G A 3: 18,097,302 S249L probably benign Het
D630023F18Rik T A 1: 65,116,691 D125V possibly damaging Het
Dbh A T 2: 27,174,848 Y357F probably damaging Het
Dbp T A 7: 45,706,990 L175Q probably benign Het
Dmwd A T 7: 19,080,843 T473S probably benign Het
Dnah9 T A 11: 66,005,660 Q2446L probably damaging Het
Dnmbp T C 19: 43,854,176 K498R probably benign Het
Dopey2 T A 16: 93,799,971 I1924N probably damaging Het
Dsg1a T A 18: 20,338,515 probably null Het
Dzank1 T C 2: 144,522,564 T38A probably damaging Het
Egfem1 A G 3: 29,686,791 H538R probably damaging Het
Entpd1 T C 19: 40,727,447 C353R probably damaging Het
Ephx2 C A 14: 66,110,229 C78F probably benign Het
Faf2 A T 13: 54,660,961 H388L probably benign Het
Fam186a G A 15: 99,944,664 T1233I possibly damaging Het
Gfra2 C A 14: 70,895,970 A80E probably damaging Het
Gif C A 19: 11,750,187 P125Q probably benign Het
Gm17175 T A 14: 51,574,035 probably benign Het
Gm8180 T C 14: 43,783,646 D35G possibly damaging Het
Gm884 T A 11: 103,614,173 H2323L possibly damaging Het
Gpr68 C T 12: 100,879,043 V81M probably damaging Het
Hsd3b6 A G 3: 98,810,943 L35P probably damaging Het
Hspd1 A C 1: 55,078,644 V485G possibly damaging Het
Il16 A G 7: 83,670,140 V381A possibly damaging Het
Il17rd G A 14: 27,100,117 C600Y probably benign Het
Ins2 C A 7: 142,679,586 probably benign Het
Itsn2 T C 12: 4,658,561 I872T probably benign Het
Jakmip3 A T 7: 139,019,129 D219V probably damaging Het
Jph4 T C 14: 55,109,735 T452A probably damaging Het
Kif20b A C 19: 34,950,955 S1206R possibly damaging Het
Lca5l A G 16: 96,162,557 probably null Het
Lgals2 A T 15: 78,851,333 S60R probably benign Het
Map10 A G 8: 125,671,611 E581G probably benign Het
Map2k7 G T 8: 4,243,744 R128L probably benign Het
Mapk8 G C 14: 33,410,877 S34* probably null Het
Mcat A G 15: 83,547,909 Y253H probably damaging Het
Mmp2 T C 8: 92,850,170 L607P probably benign Het
Ncor1 A T 11: 62,333,926 V836E probably damaging Het
Neb A G 2: 52,137,380 S7113P probably damaging Het
Nphp4 T C 4: 152,524,272 F446L possibly damaging Het
Nphp4 G T 4: 152,544,403 D749Y probably damaging Het
Olfr115 T A 17: 37,610,656 T32S probably benign Het
Olfr1185-ps1 A G 2: 88,499,072 probably benign Het
Olfr175-ps1 T C 16: 58,824,002 K236E probably damaging Het
Olfr338 T C 2: 36,376,809 I11T possibly damaging Het
Osbpl11 A T 16: 33,210,061 R220* probably null Het
Plrg1 G A 3: 83,056,837 V26M probably damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ppfia3 A C 7: 45,352,262 S560A probably benign Het
Ppp3cc T A 14: 70,225,015 N391I possibly damaging Het
Prdx6b T C 2: 80,292,960 S38P possibly damaging Het
Psg23 A T 7: 18,606,914 *472R probably null Het
Rapgef4 A T 2: 72,223,117 M587L probably benign Het
Rfx3 T A 19: 27,826,070 M247L probably benign Het
Rgs7 T A 1: 175,076,069 H463L probably benign Het
Riiad1 G T 3: 94,465,855 S106R probably benign Het
Rims4 A C 2: 163,918,628 I19S probably benign Het
Ros1 A T 10: 52,096,137 M1648K probably benign Het
Rrn3 T C 16: 13,811,589 F590L probably benign Het
Samd9l T A 6: 3,374,793 T823S possibly damaging Het
Sfxn1 C A 13: 54,091,231 P115Q possibly damaging Het
Slc10a7 T C 8: 78,698,573 probably null Het
Slc25a16 A T 10: 62,937,420 M142L probably benign Het
Stat2 CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC 10: 128,290,728 probably benign Het
Stat5a T G 11: 100,875,027 L313R probably damaging Het
Strap A G 6: 137,741,978 E176G possibly damaging Het
Tlr4 T G 4: 66,841,079 L703R probably damaging Het
Trim36 A T 18: 46,167,624 V660D possibly damaging Het
Tspoap1 T A 11: 87,775,524 D980E probably damaging Het
Usp28 T C 9: 49,003,918 V157A probably benign Het
Vmn2r17 A T 5: 109,427,873 R203S probably benign Het
Vmn2r66 T C 7: 85,007,264 I181M probably benign Het
Zan T A 5: 137,463,579 T1113S unknown Het
Zfp442 C T 2: 150,409,482 D167N possibly damaging Het
Other mutations in Kazn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Kazn APN 4 142159043 critical splice donor site probably null
IGL01959:Kazn APN 4 142150884 missense probably damaging 1.00
IGL02237:Kazn APN 4 142147099 missense probably benign 0.31
IGL02351:Kazn APN 4 142147016 critical splice donor site probably null
IGL02358:Kazn APN 4 142147016 critical splice donor site probably null
R1173:Kazn UTSW 4 142159038 splice site probably benign
R2206:Kazn UTSW 4 142118292 splice site probably null
R3406:Kazn UTSW 4 142239195 start gained probably benign
R4007:Kazn UTSW 4 142106892 missense unknown
R4050:Kazn UTSW 4 142106904 missense unknown
R4598:Kazn UTSW 4 142210092 missense possibly damaging 0.53
R4606:Kazn UTSW 4 142118288 splice site probably null
R4631:Kazn UTSW 4 142118160 unclassified probably benign
R4866:Kazn UTSW 4 142104905 missense unknown
R5050:Kazn UTSW 4 142118203 unclassified probably benign
R5052:Kazn UTSW 4 142118203 unclassified probably benign
R5054:Kazn UTSW 4 142108646 missense unknown
R5758:Kazn UTSW 4 142141671 critical splice donor site probably null
R6152:Kazn UTSW 4 142109287 missense unknown
R6284:Kazn UTSW 4 142117197 missense probably benign 0.04
R7289:Kazn UTSW 4 142117175 missense
R7414:Kazn UTSW 4 142109338 missense
R7663:Kazn UTSW 4 142104898 missense
R8031:Kazn UTSW 4 142154551 missense
R8184:Kazn UTSW 4 142118130 missense probably benign 0.04
R8315:Kazn UTSW 4 142141691 missense
R8779:Kazn UTSW 4 142154545 missense
Z1177:Kazn UTSW 4 142154504 missense
Predicted Primers PCR Primer
(F):5'- ACTCCAGGAAGCTCAGAATGG -3'
(R):5'- AACCATTGGATGCTCGGGAG -3'

Sequencing Primer
(F):5'- TGCCAACAAGCCTGTGC -3'
(R):5'- ATTGGATGCTCGGGAGTGTGG -3'
Posted On2019-11-26