Incidental Mutation 'R7814:Vmn2r17'
ID 601351
Institutional Source Beutler Lab
Gene Symbol Vmn2r17
Ensembl Gene ENSMUSG00000091879
Gene Name vomeronasal 2, receptor 17
Synonyms EG384221
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock # R7814 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 109420013-109453387 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 109427873 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 203 (R203S)
Ref Sequence ENSEMBL: ENSMUSP00000131450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171841]
AlphaFold E9PYF5
Predicted Effect probably benign
Transcript: ENSMUST00000171841
AA Change: R203S

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131450
Gene: ENSMUSG00000091879
AA Change: R203S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 465 7e-26 PFAM
Pfam:NCD3G 508 562 3.5e-18 PFAM
Pfam:7tm_3 593 830 4.8e-55 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (90/90)
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110065P20Rik C T 4: 124,850,602 G20R not run Het
4931409K22Rik G T 5: 24,545,422 Q626K possibly damaging Het
Adamts13 A T 2: 26,996,549 M927L probably benign Het
Akap6 T A 12: 53,140,961 N1719K probably benign Het
Ank3 G A 10: 69,986,904 V468M Het
Aox1 A G 1: 58,085,467 T956A probably benign Het
Ap4m1 T C 5: 138,174,817 V140A probably benign Het
Apc A G 18: 34,272,539 T173A probably damaging Het
Bclaf1 A G 10: 20,334,619 T839A possibly damaging Het
Btn2a2 T A 13: 23,482,806 I210F possibly damaging Het
Cadps A G 14: 12,376,706 W1269R probably damaging Het
Capn2 G C 1: 182,492,146 P159R probably damaging Het
Ccdc134 T G 15: 82,131,523 V68G probably damaging Het
Cdh26 A G 2: 178,470,035 T463A probably damaging Het
Cfap206 C T 4: 34,716,347 V373I probably benign Het
Clpx T C 9: 65,324,301 probably null Het
Ctnnd2 A T 15: 31,020,728 Y1145F probably benign Het
Ctr9 T A 7: 111,033,927 D127E probably benign Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Cyp7b1 G A 3: 18,097,302 S249L probably benign Het
D630023F18Rik T A 1: 65,116,691 D125V possibly damaging Het
Dbh A T 2: 27,174,848 Y357F probably damaging Het
Dbp T A 7: 45,706,990 L175Q probably benign Het
Dmwd A T 7: 19,080,843 T473S probably benign Het
Dnah9 T A 11: 66,005,660 Q2446L probably damaging Het
Dnmbp T C 19: 43,854,176 K498R probably benign Het
Dopey2 T A 16: 93,799,971 I1924N probably damaging Het
Dsg1a T A 18: 20,338,515 probably null Het
Dzank1 T C 2: 144,522,564 T38A probably damaging Het
Egfem1 A G 3: 29,686,791 H538R probably damaging Het
Entpd1 T C 19: 40,727,447 C353R probably damaging Het
Ephx2 C A 14: 66,110,229 C78F probably benign Het
Faf2 A T 13: 54,660,961 H388L probably benign Het
Fam186a G A 15: 99,944,664 T1233I possibly damaging Het
Gfra2 C A 14: 70,895,970 A80E probably damaging Het
Gif C A 19: 11,750,187 P125Q probably benign Het
Gm17175 T A 14: 51,574,035 probably benign Het
Gm8180 T C 14: 43,783,646 D35G possibly damaging Het
Gm884 T A 11: 103,614,173 H2323L possibly damaging Het
Gpr68 C T 12: 100,879,043 V81M probably damaging Het
Hsd3b6 A G 3: 98,810,943 L35P probably damaging Het
Hspd1 A C 1: 55,078,644 V485G possibly damaging Het
Il16 A G 7: 83,670,140 V381A possibly damaging Het
Il17rd G A 14: 27,100,117 C600Y probably benign Het
Ins2 C A 7: 142,679,586 probably benign Het
Itsn2 T C 12: 4,658,561 I872T probably benign Het
Jakmip3 A T 7: 139,019,129 D219V probably damaging Het
Jph4 T C 14: 55,109,735 T452A probably damaging Het
Kazn T C 4: 142,210,170 E12G unknown Het
Kif20b A C 19: 34,950,955 S1206R possibly damaging Het
Lca5l A G 16: 96,162,557 probably null Het
Lgals2 A T 15: 78,851,333 S60R probably benign Het
Map10 A G 8: 125,671,611 E581G probably benign Het
Map2k7 G T 8: 4,243,744 R128L probably benign Het
Mapk8 G C 14: 33,410,877 S34* probably null Het
Mcat A G 15: 83,547,909 Y253H probably damaging Het
Mmp2 T C 8: 92,850,170 L607P probably benign Het
Ncor1 A T 11: 62,333,926 V836E probably damaging Het
Neb A G 2: 52,137,380 S7113P probably damaging Het
Nphp4 G T 4: 152,544,403 D749Y probably damaging Het
Nphp4 T C 4: 152,524,272 F446L possibly damaging Het
Olfr115 T A 17: 37,610,656 T32S probably benign Het
Olfr1185-ps1 A G 2: 88,499,072 probably benign Het
Olfr175-ps1 T C 16: 58,824,002 K236E probably damaging Het
Olfr338 T C 2: 36,376,809 I11T possibly damaging Het
Osbpl11 A T 16: 33,210,061 R220* probably null Het
Plrg1 G A 3: 83,056,837 V26M probably damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ppfia3 A C 7: 45,352,262 S560A probably benign Het
Ppp3cc T A 14: 70,225,015 N391I possibly damaging Het
Prdx6b T C 2: 80,292,960 S38P possibly damaging Het
Psg23 A T 7: 18,606,914 *472R probably null Het
Rapgef4 A T 2: 72,223,117 M587L probably benign Het
Rfx3 T A 19: 27,826,070 M247L probably benign Het
Rgs7 T A 1: 175,076,069 H463L probably benign Het
Riiad1 G T 3: 94,465,855 S106R probably benign Het
Rims4 A C 2: 163,918,628 I19S probably benign Het
Ros1 A T 10: 52,096,137 M1648K probably benign Het
Rrn3 T C 16: 13,811,589 F590L probably benign Het
Samd9l T A 6: 3,374,793 T823S possibly damaging Het
Sfxn1 C A 13: 54,091,231 P115Q possibly damaging Het
Slc10a7 T C 8: 78,698,573 probably null Het
Slc25a16 A T 10: 62,937,420 M142L probably benign Het
Stat2 CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC 10: 128,290,728 probably benign Het
Stat5a T G 11: 100,875,027 L313R probably damaging Het
Strap A G 6: 137,741,978 E176G possibly damaging Het
Tlr4 T G 4: 66,841,079 L703R probably damaging Het
Trim36 A T 18: 46,167,624 V660D possibly damaging Het
Tspoap1 T A 11: 87,775,524 D980E probably damaging Het
Usp28 T C 9: 49,003,918 V157A probably benign Het
Vmn2r66 T C 7: 85,007,264 I181M probably benign Het
Zan T A 5: 137,463,579 T1113S unknown Het
Zfp442 C T 2: 150,409,482 D167N possibly damaging Het
Other mutations in Vmn2r17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Vmn2r17 APN 5 109427992 missense probably benign 0.15
IGL01457:Vmn2r17 APN 5 109453032 missense probably benign 0.00
IGL01527:Vmn2r17 APN 5 109453140 missense probably damaging 1.00
IGL01693:Vmn2r17 APN 5 109452518 missense probably damaging 1.00
IGL01738:Vmn2r17 APN 5 109429498 missense probably damaging 1.00
IGL01767:Vmn2r17 APN 5 109420037 missense probably benign 0.01
IGL01932:Vmn2r17 APN 5 109427050 missense probably benign 0.00
IGL01970:Vmn2r17 APN 5 109427947 missense probably damaging 0.97
IGL02009:Vmn2r17 APN 5 109452848 missense possibly damaging 0.67
IGL02365:Vmn2r17 APN 5 109453309 missense probably damaging 1.00
IGL02385:Vmn2r17 APN 5 109434381 missense probably damaging 1.00
IGL02457:Vmn2r17 APN 5 109453146 missense probably damaging 1.00
IGL02646:Vmn2r17 APN 5 109453080 missense probably damaging 1.00
IGL02741:Vmn2r17 APN 5 109420211 missense probably benign
IGL03213:Vmn2r17 APN 5 109434390 critical splice donor site probably null
IGL03216:Vmn2r17 APN 5 109452890 missense probably damaging 1.00
IGL03342:Vmn2r17 APN 5 109427916 missense probably damaging 1.00
IGL03408:Vmn2r17 APN 5 109429372 splice site probably benign
R0349:Vmn2r17 UTSW 5 109428336 missense probably damaging 1.00
R0418:Vmn2r17 UTSW 5 109452881 missense probably damaging 1.00
R0800:Vmn2r17 UTSW 5 109427326 splice site probably benign
R0836:Vmn2r17 UTSW 5 109427956 missense possibly damaging 0.89
R1715:Vmn2r17 UTSW 5 109428244 missense probably benign 0.00
R1738:Vmn2r17 UTSW 5 109428511 missense probably benign 0.10
R1801:Vmn2r17 UTSW 5 109428478 missense probably damaging 1.00
R2054:Vmn2r17 UTSW 5 109452486 missense probably damaging 0.98
R2060:Vmn2r17 UTSW 5 109427209 missense probably benign 0.00
R2192:Vmn2r17 UTSW 5 109434278 missense possibly damaging 0.81
R2315:Vmn2r17 UTSW 5 109428031 missense probably damaging 1.00
R2374:Vmn2r17 UTSW 5 109427238 missense probably benign
R3612:Vmn2r17 UTSW 5 109429597 missense probably benign 0.00
R3832:Vmn2r17 UTSW 5 109428396 missense probably damaging 1.00
R4273:Vmn2r17 UTSW 5 109452966 missense probably benign 0.44
R4494:Vmn2r17 UTSW 5 109428469 missense probably damaging 1.00
R4597:Vmn2r17 UTSW 5 109429562 missense probably benign 0.01
R4675:Vmn2r17 UTSW 5 109427183 missense probably benign 0.00
R4701:Vmn2r17 UTSW 5 109427983 missense probably damaging 0.99
R4754:Vmn2r17 UTSW 5 109452849 missense probably damaging 0.99
R4841:Vmn2r17 UTSW 5 109434380 missense probably damaging 1.00
R4842:Vmn2r17 UTSW 5 109434380 missense probably damaging 1.00
R4865:Vmn2r17 UTSW 5 109427119 missense probably damaging 1.00
R4902:Vmn2r17 UTSW 5 109453354 missense probably benign 0.14
R4989:Vmn2r17 UTSW 5 109427873 missense probably benign 0.07
R5101:Vmn2r17 UTSW 5 109428351 missense probably damaging 0.99
R5109:Vmn2r17 UTSW 5 109429476 missense probably benign 0.06
R5123:Vmn2r17 UTSW 5 109427908 missense possibly damaging 0.90
R5474:Vmn2r17 UTSW 5 109434284 missense probably damaging 1.00
R5485:Vmn2r17 UTSW 5 109420106 missense probably benign 0.06
R5611:Vmn2r17 UTSW 5 109428164 missense probably damaging 0.97
R5652:Vmn2r17 UTSW 5 109429564 missense probably benign 0.10
R5717:Vmn2r17 UTSW 5 109427274 missense possibly damaging 0.94
R5735:Vmn2r17 UTSW 5 109452850 missense possibly damaging 0.67
R5766:Vmn2r17 UTSW 5 109427273 missense possibly damaging 0.46
R6645:Vmn2r17 UTSW 5 109428381 missense probably damaging 1.00
R6786:Vmn2r17 UTSW 5 109427829 missense probably benign 0.30
R6821:Vmn2r17 UTSW 5 109429465 missense probably damaging 1.00
R6979:Vmn2r17 UTSW 5 109428399 missense possibly damaging 0.46
R6984:Vmn2r17 UTSW 5 109452667 missense probably benign 0.10
R7269:Vmn2r17 UTSW 5 109428471 missense possibly damaging 0.88
R7509:Vmn2r17 UTSW 5 109427829 missense probably benign 0.30
R7736:Vmn2r17 UTSW 5 109452891 missense probably benign 0.05
R7789:Vmn2r17 UTSW 5 109452965 missense possibly damaging 0.77
R7847:Vmn2r17 UTSW 5 109420197 missense probably damaging 1.00
R7863:Vmn2r17 UTSW 5 109420169 missense probably benign
R7893:Vmn2r17 UTSW 5 109428078 missense probably benign 0.05
R8234:Vmn2r17 UTSW 5 109453369 missense probably benign 0.01
R8382:Vmn2r17 UTSW 5 109428521 missense probably benign 0.01
R8435:Vmn2r17 UTSW 5 109428306 missense probably benign 0.01
R8465:Vmn2r17 UTSW 5 109452825 missense probably damaging 0.99
R8555:Vmn2r17 UTSW 5 109452944 missense probably damaging 0.99
R8900:Vmn2r17 UTSW 5 109427997 missense probably benign 0.25
R9293:Vmn2r17 UTSW 5 109452846 missense probably damaging 1.00
R9308:Vmn2r17 UTSW 5 109452639 missense probably damaging 0.98
R9378:Vmn2r17 UTSW 5 109427866 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACAAGCACATTACTTATGGGGATG -3'
(R):5'- ATATGCCCATCTTCTAAAGCTGAC -3'

Sequencing Primer
(F):5'- ACATTACTTATGGGGATGTTTAATCC -3'
(R):5'- ACAACCTTGGCTGATGATGTC -3'
Posted On 2019-11-26