Incidental Mutation 'R7814:Usp28'
ID601370
Institutional Source Beutler Lab
Gene Symbol Usp28
Ensembl Gene ENSMUSG00000032267
Gene Nameubiquitin specific peptidase 28
Synonyms9830148O20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7814 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location48985375-49042517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49003918 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 157 (V157A)
Ref Sequence ENSEMBL: ENSMUSP00000047467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047349] [ENSMUST00000213874] [ENSMUST00000215788]
Predicted Effect probably benign
Transcript: ENSMUST00000047349
AA Change: V157A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000047467
Gene: ENSMUSG00000032267
AA Change: V157A

DomainStartEndE-ValueType
UIM 97 116 3.1e-3 SMART
Pfam:UCH 161 652 5.4e-52 PFAM
Pfam:UCH_1 162 626 2e-11 PFAM
low complexity region 695 705 N/A INTRINSIC
low complexity region 713 730 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213874
AA Change: V157A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000215788
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a deubiquitinase involved in the DNA damage pathway and DNA damage-induced apoptosis. Overexpression of this gene is seen in several cancers. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and exhibit slightly decreased spleen weight and splenocyte number but show neither major signaling defects in DNA damage response nor developmental defects indicative of impaired double-strand break metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110065P20Rik C T 4: 124,850,602 G20R not run Het
4931409K22Rik G T 5: 24,545,422 Q626K possibly damaging Het
Adamts13 A T 2: 26,996,549 M927L probably benign Het
Akap6 T A 12: 53,140,961 N1719K probably benign Het
Ank3 G A 10: 69,986,904 V468M Het
Aox1 A G 1: 58,085,467 T956A probably benign Het
Ap4m1 T C 5: 138,174,817 V140A probably benign Het
Apc A G 18: 34,272,539 T173A probably damaging Het
Bclaf1 A G 10: 20,334,619 T839A possibly damaging Het
Btn2a2 T A 13: 23,482,806 I210F possibly damaging Het
Cadps A G 14: 12,376,706 W1269R probably damaging Het
Capn2 G C 1: 182,492,146 P159R probably damaging Het
Ccdc134 T G 15: 82,131,523 V68G probably damaging Het
Cdh26 A G 2: 178,470,035 T463A probably damaging Het
Cfap206 C T 4: 34,716,347 V373I probably benign Het
Clpx T C 9: 65,324,301 probably null Het
Ctnnd2 A T 15: 31,020,728 Y1145F probably benign Het
Ctr9 T A 7: 111,033,927 D127E probably benign Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Cyp7b1 G A 3: 18,097,302 S249L probably benign Het
D630023F18Rik T A 1: 65,116,691 D125V possibly damaging Het
Dbh A T 2: 27,174,848 Y357F probably damaging Het
Dbp T A 7: 45,706,990 L175Q probably benign Het
Dmwd A T 7: 19,080,843 T473S probably benign Het
Dnah9 T A 11: 66,005,660 Q2446L probably damaging Het
Dnmbp T C 19: 43,854,176 K498R probably benign Het
Dopey2 T A 16: 93,799,971 I1924N probably damaging Het
Dsg1a T A 18: 20,338,515 probably null Het
Dzank1 T C 2: 144,522,564 T38A probably damaging Het
Egfem1 A G 3: 29,686,791 H538R probably damaging Het
Entpd1 T C 19: 40,727,447 C353R probably damaging Het
Ephx2 C A 14: 66,110,229 C78F probably benign Het
Faf2 A T 13: 54,660,961 H388L probably benign Het
Fam186a G A 15: 99,944,664 T1233I possibly damaging Het
Gfra2 C A 14: 70,895,970 A80E probably damaging Het
Gif C A 19: 11,750,187 P125Q probably benign Het
Gm17175 T A 14: 51,574,035 probably benign Het
Gm8180 T C 14: 43,783,646 D35G possibly damaging Het
Gm884 T A 11: 103,614,173 H2323L possibly damaging Het
Gpr68 C T 12: 100,879,043 V81M probably damaging Het
Hsd3b6 A G 3: 98,810,943 L35P probably damaging Het
Hspd1 A C 1: 55,078,644 V485G possibly damaging Het
Il16 A G 7: 83,670,140 V381A possibly damaging Het
Il17rd G A 14: 27,100,117 C600Y probably benign Het
Ins2 C A 7: 142,679,586 probably benign Het
Itsn2 T C 12: 4,658,561 I872T probably benign Het
Jakmip3 A T 7: 139,019,129 D219V probably damaging Het
Jph4 T C 14: 55,109,735 T452A probably damaging Het
Kazn T C 4: 142,210,170 E12G unknown Het
Kif20b A C 19: 34,950,955 S1206R possibly damaging Het
Lca5l A G 16: 96,162,557 probably null Het
Lgals2 A T 15: 78,851,333 S60R probably benign Het
Map10 A G 8: 125,671,611 E581G probably benign Het
Map2k7 G T 8: 4,243,744 R128L probably benign Het
Mapk8 G C 14: 33,410,877 S34* probably null Het
Mcat A G 15: 83,547,909 Y253H probably damaging Het
Mmp2 T C 8: 92,850,170 L607P probably benign Het
Ncor1 A T 11: 62,333,926 V836E probably damaging Het
Neb A G 2: 52,137,380 S7113P probably damaging Het
Nphp4 T C 4: 152,524,272 F446L possibly damaging Het
Nphp4 G T 4: 152,544,403 D749Y probably damaging Het
Olfr115 T A 17: 37,610,656 T32S probably benign Het
Olfr1185-ps1 A G 2: 88,499,072 probably benign Het
Olfr175-ps1 T C 16: 58,824,002 K236E probably damaging Het
Olfr338 T C 2: 36,376,809 I11T possibly damaging Het
Osbpl11 A T 16: 33,210,061 R220* probably null Het
Plrg1 G A 3: 83,056,837 V26M probably damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ppfia3 A C 7: 45,352,262 S560A probably benign Het
Ppp3cc T A 14: 70,225,015 N391I possibly damaging Het
Prdx6b T C 2: 80,292,960 S38P possibly damaging Het
Psg23 A T 7: 18,606,914 *472R probably null Het
Rapgef4 A T 2: 72,223,117 M587L probably benign Het
Rfx3 T A 19: 27,826,070 M247L probably benign Het
Rgs7 T A 1: 175,076,069 H463L probably benign Het
Riiad1 G T 3: 94,465,855 S106R probably benign Het
Rims4 A C 2: 163,918,628 I19S probably benign Het
Ros1 A T 10: 52,096,137 M1648K probably benign Het
Rrn3 T C 16: 13,811,589 F590L probably benign Het
Samd9l T A 6: 3,374,793 T823S possibly damaging Het
Sfxn1 C A 13: 54,091,231 P115Q possibly damaging Het
Slc10a7 T C 8: 78,698,573 probably null Het
Slc25a16 A T 10: 62,937,420 M142L probably benign Het
Stat2 CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC 10: 128,290,728 probably benign Het
Stat5a T G 11: 100,875,027 L313R probably damaging Het
Strap A G 6: 137,741,978 E176G possibly damaging Het
Tlr4 T G 4: 66,841,079 L703R probably damaging Het
Trim36 A T 18: 46,167,624 V660D possibly damaging Het
Tspoap1 T A 11: 87,775,524 D980E probably damaging Het
Vmn2r17 A T 5: 109,427,873 R203S probably benign Het
Vmn2r66 T C 7: 85,007,264 I181M probably benign Het
Zan T A 5: 137,463,579 T1113S unknown Het
Zfp442 C T 2: 150,409,482 D167N possibly damaging Het
Other mutations in Usp28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Usp28 APN 9 49028163 missense probably benign 0.01
IGL01105:Usp28 APN 9 49010250 missense probably damaging 1.00
IGL01124:Usp28 APN 9 49037213 missense probably damaging 1.00
IGL01304:Usp28 APN 9 49026819 missense probably damaging 0.99
IGL01527:Usp28 APN 9 49025873 missense probably benign 0.02
IGL01859:Usp28 APN 9 49024021 nonsense probably null
IGL01860:Usp28 APN 9 49032243 nonsense probably null
IGL02047:Usp28 APN 9 49035641 missense probably damaging 0.99
IGL02188:Usp28 APN 9 49024009 missense probably benign 0.00
IGL02267:Usp28 APN 9 49023965 missense probably damaging 1.00
IGL02472:Usp28 APN 9 49037769 missense possibly damaging 0.95
IGL02675:Usp28 APN 9 49039091 missense possibly damaging 0.81
IGL02982:Usp28 APN 9 49018439 missense probably benign 0.00
IGL03105:Usp28 APN 9 49039055 missense probably damaging 0.99
R0100:Usp28 UTSW 9 49035932 missense probably damaging 1.00
R0114:Usp28 UTSW 9 49039023 missense probably benign 0.00
R0196:Usp28 UTSW 9 49028278 missense probably damaging 0.96
R0206:Usp28 UTSW 9 49028269 missense probably damaging 1.00
R0349:Usp28 UTSW 9 49010281 nonsense probably null
R0379:Usp28 UTSW 9 49024067 missense possibly damaging 0.58
R0454:Usp28 UTSW 9 49039101 missense possibly damaging 0.94
R0479:Usp28 UTSW 9 49037213 missense probably damaging 1.00
R0540:Usp28 UTSW 9 49024060 missense probably benign
R0726:Usp28 UTSW 9 49003869 missense probably damaging 1.00
R0835:Usp28 UTSW 9 49001524 missense probably damaging 1.00
R0928:Usp28 UTSW 9 49030891 missense possibly damaging 0.60
R1271:Usp28 UTSW 9 49035961 critical splice donor site probably null
R1534:Usp28 UTSW 9 48985506 missense possibly damaging 0.92
R1539:Usp28 UTSW 9 49037796 missense probably benign 0.07
R1687:Usp28 UTSW 9 49024017 missense probably benign 0.00
R1867:Usp28 UTSW 9 49009194 missense probably benign 0.00
R1868:Usp28 UTSW 9 49016707 missense probably damaging 1.00
R1884:Usp28 UTSW 9 49035947 missense probably damaging 1.00
R2029:Usp28 UTSW 9 48985503 missense probably benign 0.22
R2046:Usp28 UTSW 9 49039075 missense probably damaging 1.00
R2379:Usp28 UTSW 9 49003095 missense probably null 0.94
R2404:Usp28 UTSW 9 49037258 critical splice donor site probably null
R3196:Usp28 UTSW 9 49025825 missense probably benign 0.03
R3831:Usp28 UTSW 9 49035638 missense probably benign 0.00
R3922:Usp28 UTSW 9 49030923 critical splice donor site probably null
R3924:Usp28 UTSW 9 49030923 critical splice donor site probably null
R3926:Usp28 UTSW 9 49030923 critical splice donor site probably null
R3943:Usp28 UTSW 9 49000366 missense probably benign 0.12
R4834:Usp28 UTSW 9 49001536 missense probably damaging 1.00
R5041:Usp28 UTSW 9 49037773 missense probably benign
R5186:Usp28 UTSW 9 49010250 missense probably damaging 1.00
R5308:Usp28 UTSW 9 49037201 missense probably damaging 1.00
R5870:Usp28 UTSW 9 49025985 nonsense probably null
R6838:Usp28 UTSW 9 49000430 critical splice donor site probably null
R6959:Usp28 UTSW 9 49001542 missense probably damaging 1.00
R7058:Usp28 UTSW 9 49039156 missense probably damaging 1.00
R7348:Usp28 UTSW 9 49030877 missense probably benign 0.19
R7766:Usp28 UTSW 9 49035883 missense probably damaging 1.00
R7828:Usp28 UTSW 9 49003902 missense possibly damaging 0.95
Z1176:Usp28 UTSW 9 49035925 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCATCTGTTCAAAATACCAGCATGG -3'
(R):5'- TGCTGACCCCAAACACTTAATG -3'

Sequencing Primer
(F):5'- AGCATGGTCTGTATAGTAAATCATTC -3'
(R):5'- GTGCAGTTTAGACATCACAAATTCTC -3'
Posted On2019-11-26