Mutagenetix > Incidental Mutations

Incidental Mutation 'R7814:Ncor1'

601377

Institutional Source

Beutler Lab

Gene Symbol

Ncor1

Ensembl Gene

ENSMUSG00000018501

Gene Name

nuclear receptor co-repressor 1

Synonyms

5730405M06Rik, A230020K14Rik, Rxrip13, N-CoR

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7814 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

62316426-62458541 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 62333926 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 836 (V836E)

Ref Sequence

ENSEMBL: ENSMUSP00000038900 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018645] [ENSMUST00000037575] [ENSMUST00000101066] [ENSMUST00000101067] [ENSMUST00000155712]

Predicted Effect

probably benign
Transcript: ENSMUST00000018645
AA Change: V1890E

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000018645
Gene: ENSMUSG00000018501
AA Change: V1890E

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC
Pfam:GPS2_interact	150	239	1.4e-37	PFAM
coiled coil region	302	329	N/A	INTRINSIC
low complexity region	349	366	N/A	INTRINSIC
SANT	437	485	2.76e-7	SMART
coiled coil region	507	544	N/A	INTRINSIC
low complexity region	593	617	N/A	INTRINSIC
SANT	624	672	3.29e-14	SMART
low complexity region	710	731	N/A	INTRINSIC
low complexity region	771	788	N/A	INTRINSIC
low complexity region	888	899	N/A	INTRINSIC
low complexity region	987	995	N/A	INTRINSIC
low complexity region	1002	1013	N/A	INTRINSIC
low complexity region	1036	1049	N/A	INTRINSIC
internal_repeat_2	1061	1298	1.62e-6	PROSPERO
internal_repeat_2	1299	1515	1.62e-6	PROSPERO
low complexity region	1516	1527	N/A	INTRINSIC
coiled coil region	1712	1749	N/A	INTRINSIC
low complexity region	1834	1848	N/A	INTRINSIC
low complexity region	1969	1980	N/A	INTRINSIC
low complexity region	2036	2055	N/A	INTRINSIC
PDB:3N00\|B	2064	2084	4e-7	PDB
low complexity region	2086	2101	N/A	INTRINSIC
low complexity region	2157	2168	N/A	INTRINSIC
PDB:2OVM\|B	2267	2290	2e-8	PDB
low complexity region	2311	2324	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000037575
AA Change: V836E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000038900
Gene: ENSMUSG00000018501
AA Change: V836E

Domain	Start	End	E-Value	Type
low complexity region	28	41	N/A	INTRINSIC
low complexity region	461	472	N/A	INTRINSIC
coiled coil region	658	695	N/A	INTRINSIC
low complexity region	780	794	N/A	INTRINSIC
low complexity region	915	926	N/A	INTRINSIC
low complexity region	982	1001	N/A	INTRINSIC
PDB:3N00\|B	1010	1030	2e-7	PDB
low complexity region	1032	1047	N/A	INTRINSIC
low complexity region	1102	1113	N/A	INTRINSIC
PDB:2OVM\|B	1212	1235	2e-8	PDB
low complexity region	1256	1269	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000101066
AA Change: V1890E

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000098627
Gene: ENSMUSG00000018501
AA Change: V1890E

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC
coiled coil region	176	217	N/A	INTRINSIC
coiled coil region	302	329	N/A	INTRINSIC
low complexity region	349	366	N/A	INTRINSIC
SANT	437	485	2.76e-7	SMART
coiled coil region	507	544	N/A	INTRINSIC
low complexity region	593	617	N/A	INTRINSIC
SANT	624	672	3.29e-14	SMART
low complexity region	710	731	N/A	INTRINSIC
low complexity region	771	788	N/A	INTRINSIC
low complexity region	888	899	N/A	INTRINSIC
low complexity region	987	995	N/A	INTRINSIC
low complexity region	1002	1013	N/A	INTRINSIC
low complexity region	1036	1049	N/A	INTRINSIC
internal_repeat_2	1061	1298	1.62e-6	PROSPERO
internal_repeat_2	1299	1515	1.62e-6	PROSPERO
low complexity region	1516	1527	N/A	INTRINSIC
coiled coil region	1712	1749	N/A	INTRINSIC
low complexity region	1834	1848	N/A	INTRINSIC
low complexity region	1969	1980	N/A	INTRINSIC
low complexity region	2036	2055	N/A	INTRINSIC
PDB:3N00\|B	2064	2084	4e-7	PDB
low complexity region	2086	2101	N/A	INTRINSIC
low complexity region	2157	2168	N/A	INTRINSIC
PDB:2OVM\|B	2267	2290	2e-8	PDB
low complexity region	2311	2324	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000101067
AA Change: V1823E

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000098628
Gene: ENSMUSG00000018501
AA Change: V1823E

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC
coiled coil region	176	217	N/A	INTRINSIC
coiled coil region	302	329	N/A	INTRINSIC
low complexity region	349	366	N/A	INTRINSIC
SANT	437	485	2.76e-7	SMART
coiled coil region	507	544	N/A	INTRINSIC
low complexity region	593	617	N/A	INTRINSIC
SANT	624	672	3.29e-14	SMART
low complexity region	716	734	N/A	INTRINSIC
low complexity region	838	849	N/A	INTRINSIC
low complexity region	937	945	N/A	INTRINSIC
low complexity region	952	963	N/A	INTRINSIC
low complexity region	986	999	N/A	INTRINSIC
low complexity region	1448	1459	N/A	INTRINSIC
coiled coil region	1645	1682	N/A	INTRINSIC
low complexity region	1767	1781	N/A	INTRINSIC
low complexity region	1902	1913	N/A	INTRINSIC
low complexity region	1969	1988	N/A	INTRINSIC
PDB:3N00\|B	1997	2017	4e-7	PDB
low complexity region	2019	2034	N/A	INTRINSIC
low complexity region	2089	2100	N/A	INTRINSIC
PDB:2OVM\|B	2199	2222	2e-8	PDB
low complexity region	2243	2256	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000155712
AA Change: V1160E

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000122654
Gene: ENSMUSG00000018501
AA Change: V1160E

Domain	Start	End	E-Value	Type
low complexity region	26	47	N/A	INTRINSIC
low complexity region	87	104	N/A	INTRINSIC
low complexity region	204	215	N/A	INTRINSIC
low complexity region	303	311	N/A	INTRINSIC
low complexity region	318	329	N/A	INTRINSIC
low complexity region	352	365	N/A	INTRINSIC
low complexity region	785	796	N/A	INTRINSIC
coiled coil region	982	1019	N/A	INTRINSIC
low complexity region	1104	1118	N/A	INTRINSIC
low complexity region	1239	1250	N/A	INTRINSIC
low complexity region	1306	1325	N/A	INTRINSIC
PDB:3N00\|B	1334	1354	3e-7	PDB
low complexity region	1356	1371	N/A	INTRINSIC
low complexity region	1427	1438	N/A	INTRINSIC
PDB:2OVM\|B	1537	1560	2e-8	PDB
low complexity region	1581	1594	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000156740
AA Change: V825E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000125458
Gene: ENSMUSG00000018501
AA Change: V825E

Domain	Start	End	E-Value	Type
low complexity region	18	31	N/A	INTRINSIC
low complexity region	451	462	N/A	INTRINSIC
coiled coil region	647	684	N/A	INTRINSIC
low complexity region	770	784	N/A	INTRINSIC
low complexity region	905	916	N/A	INTRINSIC
low complexity region	972	991	N/A	INTRINSIC
PDB:3N00\|B	1000	1020	2e-7	PDB
low complexity region	1022	1037	N/A	INTRINSIC
low complexity region	1092	1103	N/A	INTRINSIC
PDB:2OVM\|B	1202	1225	2e-8	PDB
low complexity region	1246	1259	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that mediates ligand-independent transcription repression of thyroid-hormone and retinoic-acid receptors by promoting chromatin condensation and preventing access of the transcription machinery. It is part of a complex which also includes histone deacetylases and transcriptional regulators similar to the yeast protein Sin3p. This gene is located between the Charcot-Marie-Tooth and Smith-Magenis syndrome critical regions on chromosome 17. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 17 and 20.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene exhibit embryonic lethality with erythrocytic, thymocytic and central nervous system development abnormalities. Mice homozygous for a hypomorphic allele exhibit increased thyroid hormone sensitivity under hypothyroid conditions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110065P20Rik	C	T	4: 124,850,602	G20R	not run	Het
4931409K22Rik	G	T	5: 24,545,422	Q626K	possibly damaging	Het
Adamts13	A	T	2: 26,996,549	M927L	probably benign	Het
Akap6	T	A	12: 53,140,961	N1719K	probably benign	Het
Ank3	G	A	10: 69,986,904	V468M		Het
Aox1	A	G	1: 58,085,467	T956A	probably benign	Het
Ap4m1	T	C	5: 138,174,817	V140A	probably benign	Het
Apc	A	G	18: 34,272,539	T173A	probably damaging	Het
Bclaf1	A	G	10: 20,334,619	T839A	possibly damaging	Het
Btn2a2	T	A	13: 23,482,806	I210F	possibly damaging	Het
Cadps	A	G	14: 12,376,706	W1269R	probably damaging	Het
Capn2	G	C	1: 182,492,146	P159R	probably damaging	Het
Ccdc134	T	G	15: 82,131,523	V68G	probably damaging	Het
Cdh26	A	G	2: 178,470,035	T463A	probably damaging	Het
Cfap206	C	T	4: 34,716,347	V373I	probably benign	Het
Clpx	T	C	9: 65,324,301		probably null	Het
Ctnnd2	A	T	15: 31,020,728	Y1145F	probably benign	Het
Ctr9	T	A	7: 111,033,927	D127E	probably benign	Het
Cyp2f2	G	A	7: 27,129,253	V183I	probably benign	Het
Cyp7b1	G	A	3: 18,097,302	S249L	probably benign	Het
D630023F18Rik	T	A	1: 65,116,691	D125V	possibly damaging	Het
Dbh	A	T	2: 27,174,848	Y357F	probably damaging	Het
Dbp	T	A	7: 45,706,990	L175Q	probably benign	Het
Dmwd	A	T	7: 19,080,843	T473S	probably benign	Het
Dnah9	T	A	11: 66,005,660	Q2446L	probably damaging	Het
Dnmbp	T	C	19: 43,854,176	K498R	probably benign	Het
Dopey2	T	A	16: 93,799,971	I1924N	probably damaging	Het
Dzank1	T	C	2: 144,522,564	T38A	probably damaging	Het
Egfem1	A	G	3: 29,686,791	H538R	probably damaging	Het
Entpd1	T	C	19: 40,727,447	C353R	probably damaging	Het
Ephx2	C	A	14: 66,110,229	C78F	probably benign	Het
Faf2	A	T	13: 54,660,961	H388L	probably benign	Het
Fam186a	G	A	15: 99,944,664	T1233I	possibly damaging	Het
Gfra2	C	A	14: 70,895,970	A80E	probably damaging	Het
Gif	C	A	19: 11,750,187	P125Q	probably benign	Het
Gm17175	T	A	14: 51,574,035		probably benign	Het
Gm8180	T	C	14: 43,783,646	D35G	possibly damaging	Het
Gm884	T	A	11: 103,614,173	H2323L	possibly damaging	Het
Gpr68	C	T	12: 100,879,043	V81M	probably damaging	Het
Hsd3b6	A	G	3: 98,810,943	L35P	probably damaging	Het
Hspd1	A	C	1: 55,078,644	V485G	possibly damaging	Het
Il16	A	G	7: 83,670,140	V381A	possibly damaging	Het
Il17rd	G	A	14: 27,100,117	C600Y	probably benign	Het
Ins2	C	A	7: 142,679,586		probably benign	Het
Itsn2	T	C	12: 4,658,561	I872T	probably benign	Het
Jakmip3	A	T	7: 139,019,129	D219V	probably damaging	Het
Jph4	T	C	14: 55,109,735	T452A	probably damaging	Het
Kazn	T	C	4: 142,210,170	E12G	unknown	Het
Kif20b	A	C	19: 34,950,955	S1206R	possibly damaging	Het
Lca5l	A	G	16: 96,162,557		probably null	Het
Lgals2	A	T	15: 78,851,333	S60R	probably benign	Het
Map10	A	G	8: 125,671,611	E581G	probably benign	Het
Map2k7	G	T	8: 4,243,744	R128L	probably benign	Het
Mapk8	G	C	14: 33,410,877	S34*	probably null	Het
Mcat	A	G	15: 83,547,909	Y253H	probably damaging	Het
Mmp2	T	C	8: 92,850,170	L607P	probably benign	Het
Neb	A	G	2: 52,137,380	S7113P	probably damaging	Het
Nphp4	T	C	4: 152,524,272	F446L	possibly damaging	Het
Nphp4	G	T	4: 152,544,403	D749Y	probably damaging	Het
Olfr115	T	A	17: 37,610,656	T32S	probably benign	Het
Olfr1185-ps1	A	G	2: 88,499,072		probably benign	Het
Olfr175-ps1	T	C	16: 58,824,002	K236E	probably damaging	Het
Olfr338	T	C	2: 36,376,809	I11T	possibly damaging	Het
Osbpl11	A	T	16: 33,210,061	R220*	probably null	Het
Plrg1	G	A	3: 83,056,837	V26M	probably damaging	Het
Polr1b	C	A	2: 129,125,544	F952L	probably damaging	Het
Ppfia3	A	C	7: 45,352,262	S560A	probably benign	Het
Ppp3cc	T	A	14: 70,225,015	N391I	possibly damaging	Het
Prdx6b	T	C	2: 80,292,960	S38P	possibly damaging	Het
Psg23	A	T	7: 18,606,914	*472R	probably null	Het
Rapgef4	A	T	2: 72,223,117	M587L	probably benign	Het
Rfx3	T	A	19: 27,826,070	M247L	probably benign	Het
Rgs7	T	A	1: 175,076,069	H463L	probably benign	Het
Riiad1	G	T	3: 94,465,855	S106R	probably benign	Het
Rims4	A	C	2: 163,918,628	I19S	probably benign	Het
Ros1	A	T	10: 52,096,137	M1648K	probably benign	Het
Rrn3	T	C	16: 13,811,589	F590L	probably benign	Het
Samd9l	T	A	6: 3,374,793	T823S	possibly damaging	Het
Sfxn1	C	A	13: 54,091,231	P115Q	possibly damaging	Het
Slc10a7	T	C	8: 78,698,573		probably null	Het
Slc25a16	A	T	10: 62,937,420	M142L	probably benign	Het
Srd5a1	ACTCCATGCTTACCCCTGGGTATTTTGTATCCAGTTTCCCTCCATGCTTACCCCTGGGTATTTTGTATCCAGTTTCCCTCCATGCTTACCCCTGGGTATTTTGTATCCAGTTTCCCTCCATGCTTACCCCTGGGTATTTTGTATCCAGTTTCCC	ACTCCATGCTTACCCCTGGGTATTTTGTATCCAGTTTCCCTCCATGCTTACCCCTGGGTATTTTGTATCCAGTTTCCCTCCATGCTTACCCCTGGGTATTTTGTATCCAGTTTCCC	13: 69,594,789		probably benign	Het
Stat2	CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC	CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC	10: 128,290,728		probably benign	Het
Stat5a	T	G	11: 100,875,027	L313R	probably damaging	Het
Strap	A	G	6: 137,741,978	E176G	possibly damaging	Het
Tlr4	T	G	4: 66,841,079	L703R	probably damaging	Het
Trim36	A	T	18: 46,167,624	V660D	possibly damaging	Het
Tspoap1	T	A	11: 87,775,524	D980E	probably damaging	Het
Usp28	T	C	9: 49,003,918	V157A	probably benign	Het
Vmn2r17	A	T	5: 109,427,873	R203S	probably benign	Het
Vmn2r66	T	C	7: 85,007,264	I181M	probably benign	Het
Zan	T	A	5: 137,463,579	T1113S	unknown	Het
Zfp442	C	T	2: 150,409,482	D167N	possibly damaging	Het

Other mutations in Ncor1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01067:Ncor1	APN	11	62392528	missense	probably damaging	1.00
IGL01343:Ncor1	APN	11	62325486	critical splice donor site	probably null
IGL01392:Ncor1	APN	11	62340594	missense	probably damaging	0.99
IGL01402:Ncor1	APN	11	62340474	missense	probably damaging	1.00
IGL01714:Ncor1	APN	11	62334584	missense	possibly damaging	0.58
IGL01772:Ncor1	APN	11	62349347	intron	probably benign
IGL01889:Ncor1	APN	11	62334601	missense	possibly damaging	0.69
IGL02058:Ncor1	APN	11	62344637	missense	probably damaging	1.00
IGL02065:Ncor1	APN	11	62419609	missense	possibly damaging	0.95
IGL02073:Ncor1	APN	11	62358917	missense	probably damaging	0.99
IGL02176:Ncor1	APN	11	62329659	unclassified	probably benign
IGL02288:Ncor1	APN	11	62349403	missense	probably benign	0.01
IGL02348:Ncor1	APN	11	62333659	splice site	probably benign
IGL02608:Ncor1	APN	11	62373214	missense	probably benign	0.07
LCD18:Ncor1	UTSW	11	62419782	critical splice acceptor site	probably benign
PIT4382001:Ncor1	UTSW	11	62344663	missense	probably damaging	0.96
PIT4576001:Ncor1	UTSW	11	62333717	missense	probably damaging	0.99
R0026:Ncor1	UTSW	11	62438429	missense	probably damaging	1.00
R0038:Ncor1	UTSW	11	62392551	missense	probably damaging	0.99
R0038:Ncor1	UTSW	11	62392551	missense	probably damaging	0.99
R0103:Ncor1	UTSW	11	62343045	missense	possibly damaging	0.85
R0103:Ncor1	UTSW	11	62343045	missense	possibly damaging	0.85
R0144:Ncor1	UTSW	11	62392595	missense	probably damaging	1.00
R0427:Ncor1	UTSW	11	62410920	missense	probably damaging	1.00
R0501:Ncor1	UTSW	11	62373322	missense	possibly damaging	0.73
R0544:Ncor1	UTSW	11	62333776	missense	probably damaging	1.00
R0544:Ncor1	UTSW	11	62333777	missense	probably damaging	1.00
R0563:Ncor1	UTSW	11	62343230	missense	probably damaging	0.97
R1074:Ncor1	UTSW	11	62392551	missense	probably damaging	0.99
R1266:Ncor1	UTSW	11	62334040	missense	probably damaging	0.98
R1444:Ncor1	UTSW	11	62403806	missense	probably damaging	1.00
R1452:Ncor1	UTSW	11	62334631	missense	probably damaging	1.00
R1534:Ncor1	UTSW	11	62378504	missense	possibly damaging	0.92
R1710:Ncor1	UTSW	11	62423005	missense	probably damaging	1.00
R1762:Ncor1	UTSW	11	62384784	missense	possibly damaging	0.82
R1771:Ncor1	UTSW	11	62327112	missense	probably damaging	1.00
R1864:Ncor1	UTSW	11	62381419	missense	probably damaging	1.00
R1902:Ncor1	UTSW	11	62338158	missense	probably damaging	1.00
R1906:Ncor1	UTSW	11	62349385	missense	possibly damaging	0.81
R2009:Ncor1	UTSW	11	62325601	missense	probably benign	0.43
R3708:Ncor1	UTSW	11	62344687	missense	probably damaging	1.00
R3825:Ncor1	UTSW	11	62373357	missense	probably benign	0.00
R3923:Ncor1	UTSW	11	62325616	missense	probably damaging	1.00
R3966:Ncor1	UTSW	11	62344757	missense	probably damaging	1.00
R4049:Ncor1	UTSW	11	62329668	intron	probably null
R4350:Ncor1	UTSW	11	62410818	critical splice donor site	probably null
R4351:Ncor1	UTSW	11	62410818	critical splice donor site	probably null
R4359:Ncor1	UTSW	11	62358910	missense	probably damaging	1.00
R4712:Ncor1	UTSW	11	62344834	missense	probably damaging	1.00
R4723:Ncor1	UTSW	11	62378612	missense	probably benign	0.26
R4863:Ncor1	UTSW	11	62392638	missense	possibly damaging	0.92
R4875:Ncor1	UTSW	11	62433611	small deletion	probably benign
R4956:Ncor1	UTSW	11	62340605	missense	probably damaging	1.00
R4993:Ncor1	UTSW	11	62343341	missense	probably damaging	1.00
R5079:Ncor1	UTSW	11	62345237	missense	possibly damaging	0.92
R5144:Ncor1	UTSW	11	62349464	missense	probably damaging	1.00
R5223:Ncor1	UTSW	11	62339000	missense	probably damaging	1.00
R5243:Ncor1	UTSW	11	62338962	missense	probably damaging	1.00
R5271:Ncor1	UTSW	11	62340545	missense	probably damaging	1.00
R5285:Ncor1	UTSW	11	62392649	missense	probably damaging	1.00
R5533:Ncor1	UTSW	11	62343011	missense	probably benign	0.00
R5580:Ncor1	UTSW	11	62389778	nonsense	probably null
R5593:Ncor1	UTSW	11	62369304	missense	probably damaging	1.00
R5609:Ncor1	UTSW	11	62358853	unclassified	probably null
R5632:Ncor1	UTSW	11	62338234	missense	possibly damaging	0.85
R5830:Ncor1	UTSW	11	62344763	missense	possibly damaging	0.71
R5896:Ncor1	UTSW	11	62383190	missense	probably damaging	1.00
R5973:Ncor1	UTSW	11	62349310	intron	probably null
R6013:Ncor1	UTSW	11	62321077	missense	probably benign
R6019:Ncor1	UTSW	11	62373161	missense	probably benign	0.00
R6032:Ncor1	UTSW	11	62373321	missense	possibly damaging	0.54
R6032:Ncor1	UTSW	11	62373321	missense	possibly damaging	0.54
R6075:Ncor1	UTSW	11	62317849	missense	probably damaging	1.00
R6091:Ncor1	UTSW	11	62419617	missense	probably damaging	0.98
R6248:Ncor1	UTSW	11	62366982	missense	probably damaging	1.00
R6281:Ncor1	UTSW	11	62373545	missense	possibly damaging	0.71
R6351:Ncor1	UTSW	11	62373298	missense	probably benign	0.30
R6469:Ncor1	UTSW	11	62343302	missense	probably damaging	1.00
R6502:Ncor1	UTSW	11	62381414	nonsense	probably null
R6614:Ncor1	UTSW	11	62330819	missense	probably benign	0.01
R6650:Ncor1	UTSW	11	62334541	missense	probably damaging	1.00
R6765:Ncor1	UTSW	11	62373446	missense	probably benign	0.01
R6852:Ncor1	UTSW	11	62343245	missense	probably damaging	0.97
R6909:Ncor1	UTSW	11	62329486	missense	probably damaging	1.00
R6965:Ncor1	UTSW	11	62353233	critical splice donor site	probably null
R7054:Ncor1	UTSW	11	62384793	missense	probably null
R7248:Ncor1	UTSW	11	62384772	missense	possibly damaging	0.89
R7352:Ncor1	UTSW	11	62333911	missense	probably damaging	0.99
R7396:Ncor1	UTSW	11	62343218	missense	probably damaging	0.99
R7434:Ncor1	UTSW	11	62383199	missense	probably damaging	0.99
R7552:Ncor1	UTSW	11	62373424	missense	possibly damaging	0.53
R7565:Ncor1	UTSW	11	62401265	missense	probably damaging	1.00
R7575:Ncor1	UTSW	11	62383256	missense	probably benign	0.21
R7622:Ncor1	UTSW	11	62317968	missense	probably benign	0.00
R7664:Ncor1	UTSW	11	62398328	missense	probably damaging	1.00
X0065:Ncor1	UTSW	11	62354569	critical splice donor site	probably null
X0065:Ncor1	UTSW	11	62358991	missense	probably benign	0.23
Z1176:Ncor1	UTSW	11	62438516	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CATCCTTGTCCGAGGCAATTTG -3'
(R):5'- TACAACACTGCTGCGGATGC -3'

Sequencing Primer
(F):5'- CACGTCTATGAAGTTAGCTGCAG -3'
(R):5'- GATGCCCTGGCTGCTCTTG -3'

Posted On

2019-11-26