Mutagenetix > Incidental Mutation

Incidental Mutation 'R7814:Cadps'

601389

Institutional Source

Beutler Lab

Gene Symbol

Cadps

Ensembl Gene

ENSMUSG00000054423

Gene Name

Ca2+-dependent secretion activator

Synonyms

CAPS1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7814 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12372563-12823079 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12376706 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 1269 (W1269R)

Ref Sequence

ENSEMBL: ENSMUSP00000064706 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067491] [ENSMUST00000112657] [ENSMUST00000112658] [ENSMUST00000177814] [ENSMUST00000224882]

AlphaFold

Q80TJ1

Predicted Effect

probably damaging
Transcript: ENSMUST00000067491
AA Change: W1269R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000064706
Gene: ENSMUSG00000054423
AA Change: W1269R

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	41	75	N/A	INTRINSIC
coiled coil region	93	121	N/A	INTRINSIC
C2	397	492	1.08e-2	SMART
PH	520	624	1.78e-10	SMART
low complexity region	772	783	N/A	INTRINSIC
DUF1041	833	948	6.21e-54	SMART
low complexity region	1022	1045	N/A	INTRINSIC
low complexity region	1354	1361	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112657
AA Change: W1262R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108276
Gene: ENSMUSG00000054423
AA Change: W1262R

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	41	75	N/A	INTRINSIC
coiled coil region	93	121	N/A	INTRINSIC
C2	397	492	1.08e-2	SMART
PH	520	624	1.78e-10	SMART
low complexity region	775	786	N/A	INTRINSIC
DUF1041	836	941	3.88e-55	SMART
low complexity region	1015	1038	N/A	INTRINSIC
low complexity region	1347	1354	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112658
AA Change: W1263R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000108277
Gene: ENSMUSG00000054423
AA Change: W1263R

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	41	75	N/A	INTRINSIC
coiled coil region	93	121	N/A	INTRINSIC
C2	397	492	1.08e-2	SMART
PH	520	624	1.78e-10	SMART
low complexity region	776	787	N/A	INTRINSIC
DUF1041	837	942	3.88e-55	SMART
low complexity region	1016	1039	N/A	INTRINSIC
low complexity region	1348	1355	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000177814
AA Change: W1264R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000136076
Gene: ENSMUSG00000054423
AA Change: W1264R

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	41	75	N/A	INTRINSIC
coiled coil region	93	121	N/A	INTRINSIC
C2	397	492	1.08e-2	SMART
PH	520	624	1.78e-10	SMART
low complexity region	777	788	N/A	INTRINSIC
DUF1041	838	943	2.75e-55	SMART
low complexity region	1017	1040	N/A	INTRINSIC
low complexity region	1349	1356	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000224882

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (90/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel neural/endocrine-specific cytosolic and peripheral membrane protein required for the Ca2+-regulated exocytosis of secretory vesicles. The protein acts at a stage in exocytosis that follows ATP-dependent priming, which involves the essential synthesis of phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2). Alternative splicing has been observed at this locus and three variants, encoding distinct isoforms, are described. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality, respiratory failure and abnormal adrenal gland physiology. Adult heterozygous null mice display abnormal adrenal gland physiology that is different from that seen in homozygous neonates. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110065P20Rik	C	T	4: 124,850,602	G20R	not run	Het
4931409K22Rik	G	T	5: 24,545,422	Q626K	possibly damaging	Het
Adamts13	A	T	2: 26,996,549	M927L	probably benign	Het
Akap6	T	A	12: 53,140,961	N1719K	probably benign	Het
Ank3	G	A	10: 69,986,904	V468M		Het
Aox1	A	G	1: 58,085,467	T956A	probably benign	Het
Ap4m1	T	C	5: 138,174,817	V140A	probably benign	Het
Apc	A	G	18: 34,272,539	T173A	probably damaging	Het
Bclaf1	A	G	10: 20,334,619	T839A	possibly damaging	Het
Btn2a2	T	A	13: 23,482,806	I210F	possibly damaging	Het
Capn2	G	C	1: 182,492,146	P159R	probably damaging	Het
Ccdc134	T	G	15: 82,131,523	V68G	probably damaging	Het
Cdh26	A	G	2: 178,470,035	T463A	probably damaging	Het
Cfap206	C	T	4: 34,716,347	V373I	probably benign	Het
Clpx	T	C	9: 65,324,301		probably null	Het
Ctnnd2	A	T	15: 31,020,728	Y1145F	probably benign	Het
Ctr9	T	A	7: 111,033,927	D127E	probably benign	Het
Cyp2f2	G	A	7: 27,129,253	V183I	probably benign	Het
Cyp7b1	G	A	3: 18,097,302	S249L	probably benign	Het
D630023F18Rik	T	A	1: 65,116,691	D125V	possibly damaging	Het
Dbh	A	T	2: 27,174,848	Y357F	probably damaging	Het
Dbp	T	A	7: 45,706,990	L175Q	probably benign	Het
Dmwd	A	T	7: 19,080,843	T473S	probably benign	Het
Dnah9	T	A	11: 66,005,660	Q2446L	probably damaging	Het
Dnmbp	T	C	19: 43,854,176	K498R	probably benign	Het
Dopey2	T	A	16: 93,799,971	I1924N	probably damaging	Het
Dsg1a	T	A	18: 20,338,515		probably null	Het
Dzank1	T	C	2: 144,522,564	T38A	probably damaging	Het
Egfem1	A	G	3: 29,686,791	H538R	probably damaging	Het
Entpd1	T	C	19: 40,727,447	C353R	probably damaging	Het
Ephx2	C	A	14: 66,110,229	C78F	probably benign	Het
Faf2	A	T	13: 54,660,961	H388L	probably benign	Het
Fam186a	G	A	15: 99,944,664	T1233I	possibly damaging	Het
Gfra2	C	A	14: 70,895,970	A80E	probably damaging	Het
Gif	C	A	19: 11,750,187	P125Q	probably benign	Het
Gm17175	T	A	14: 51,574,035		probably benign	Het
Gm8180	T	C	14: 43,783,646	D35G	possibly damaging	Het
Gm884	T	A	11: 103,614,173	H2323L	possibly damaging	Het
Gpr68	C	T	12: 100,879,043	V81M	probably damaging	Het
Hsd3b6	A	G	3: 98,810,943	L35P	probably damaging	Het
Hspd1	A	C	1: 55,078,644	V485G	possibly damaging	Het
Il16	A	G	7: 83,670,140	V381A	possibly damaging	Het
Il17rd	G	A	14: 27,100,117	C600Y	probably benign	Het
Ins2	C	A	7: 142,679,586		probably benign	Het
Itsn2	T	C	12: 4,658,561	I872T	probably benign	Het
Jakmip3	A	T	7: 139,019,129	D219V	probably damaging	Het
Jph4	T	C	14: 55,109,735	T452A	probably damaging	Het
Kazn	T	C	4: 142,210,170	E12G	unknown	Het
Kif20b	A	C	19: 34,950,955	S1206R	possibly damaging	Het
Lca5l	A	G	16: 96,162,557		probably null	Het
Lgals2	A	T	15: 78,851,333	S60R	probably benign	Het
Map10	A	G	8: 125,671,611	E581G	probably benign	Het
Map2k7	G	T	8: 4,243,744	R128L	probably benign	Het
Mapk8	G	C	14: 33,410,877	S34*	probably null	Het
Mcat	A	G	15: 83,547,909	Y253H	probably damaging	Het
Mmp2	T	C	8: 92,850,170	L607P	probably benign	Het
Ncor1	A	T	11: 62,333,926	V836E	probably damaging	Het
Neb	A	G	2: 52,137,380	S7113P	probably damaging	Het
Nphp4	T	C	4: 152,524,272	F446L	possibly damaging	Het
Nphp4	G	T	4: 152,544,403	D749Y	probably damaging	Het
Olfr115	T	A	17: 37,610,656	T32S	probably benign	Het
Olfr1185-ps1	A	G	2: 88,499,072		probably benign	Het
Olfr175-ps1	T	C	16: 58,824,002	K236E	probably damaging	Het
Olfr338	T	C	2: 36,376,809	I11T	possibly damaging	Het
Osbpl11	A	T	16: 33,210,061	R220*	probably null	Het
Plrg1	G	A	3: 83,056,837	V26M	probably damaging	Het
Polr1b	C	A	2: 129,125,544	F952L	probably damaging	Het
Ppfia3	A	C	7: 45,352,262	S560A	probably benign	Het
Ppp3cc	T	A	14: 70,225,015	N391I	possibly damaging	Het
Prdx6b	T	C	2: 80,292,960	S38P	possibly damaging	Het
Psg23	A	T	7: 18,606,914	*472R	probably null	Het
Rapgef4	A	T	2: 72,223,117	M587L	probably benign	Het
Rfx3	T	A	19: 27,826,070	M247L	probably benign	Het
Rgs7	T	A	1: 175,076,069	H463L	probably benign	Het
Riiad1	G	T	3: 94,465,855	S106R	probably benign	Het
Rims4	A	C	2: 163,918,628	I19S	probably benign	Het
Ros1	A	T	10: 52,096,137	M1648K	probably benign	Het
Rrn3	T	C	16: 13,811,589	F590L	probably benign	Het
Samd9l	T	A	6: 3,374,793	T823S	possibly damaging	Het
Sfxn1	C	A	13: 54,091,231	P115Q	possibly damaging	Het
Slc10a7	T	C	8: 78,698,573		probably null	Het
Slc25a16	A	T	10: 62,937,420	M142L	probably benign	Het
Stat2	CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC	CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC	10: 128,290,728		probably benign	Het
Stat5a	T	G	11: 100,875,027	L313R	probably damaging	Het
Strap	A	G	6: 137,741,978	E176G	possibly damaging	Het
Tlr4	T	G	4: 66,841,079	L703R	probably damaging	Het
Trim36	A	T	18: 46,167,624	V660D	possibly damaging	Het
Tspoap1	T	A	11: 87,775,524	D980E	probably damaging	Het
Usp28	T	C	9: 49,003,918	V157A	probably benign	Het
Vmn2r17	A	T	5: 109,427,873	R203S	probably benign	Het
Vmn2r66	T	C	7: 85,007,264	I181M	probably benign	Het
Zan	T	A	5: 137,463,579	T1113S	unknown	Het
Zfp442	C	T	2: 150,409,482	D167N	possibly damaging	Het

Other mutations in Cadps

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00926:Cadps	APN	14	12491795	missense	probably damaging	1.00
IGL00990:Cadps	APN	14	12715374	missense	possibly damaging	0.56
IGL01071:Cadps	APN	14	12509091	splice site	probably null
IGL01339:Cadps	APN	14	12486543	missense	possibly damaging	0.58
IGL01518:Cadps	APN	14	12522352	missense	probably damaging	1.00
IGL01560:Cadps	APN	14	12491792	missense	probably damaging	1.00
IGL01598:Cadps	APN	14	12522202	critical splice donor site	probably null
IGL01603:Cadps	APN	14	12454154	splice site	probably benign
IGL01836:Cadps	APN	14	12522311	missense	probably damaging	1.00
IGL01839:Cadps	APN	14	12467184	splice site	probably benign
IGL01932:Cadps	APN	14	12373609	utr 3 prime	probably benign
IGL02172:Cadps	APN	14	12705681	missense	probably damaging	1.00
IGL02175:Cadps	APN	14	12467092	missense	probably damaging	0.96
IGL02212:Cadps	APN	14	12522345	missense	possibly damaging	0.94
IGL02351:Cadps	APN	14	12597380	missense	probably damaging	0.99
IGL02358:Cadps	APN	14	12597380	missense	probably damaging	0.99
IGL02499:Cadps	APN	14	12822725	nonsense	probably null
IGL02505:Cadps	APN	14	12449759	missense	probably damaging	1.00
IGL02591:Cadps	APN	14	12473465	missense	probably damaging	1.00
IGL02592:Cadps	APN	14	12473465	missense	probably damaging	1.00
IGL02671:Cadps	APN	14	12491824	missense	probably damaging	1.00
IGL02956:Cadps	APN	14	12418047	splice site	probably benign
IGL03029:Cadps	APN	14	12376675	missense	probably damaging	1.00
IGL03216:Cadps	APN	14	12439944	missense	probably damaging	1.00
IGL03282:Cadps	APN	14	12465856	splice site	probably benign
turbo	UTSW	14	12491800	missense	probably damaging	1.00
R0241:Cadps	UTSW	14	12376675	missense	probably damaging	1.00
R0241:Cadps	UTSW	14	12376675	missense	probably damaging	1.00
R0420:Cadps	UTSW	14	12491800	missense	probably damaging	1.00
R1180:Cadps	UTSW	14	12457836	splice site	probably benign
R1398:Cadps	UTSW	14	12449822	missense	probably damaging	1.00
R1678:Cadps	UTSW	14	12517802	critical splice donor site	probably null
R1792:Cadps	UTSW	14	12449802	missense	possibly damaging	0.93
R1863:Cadps	UTSW	14	12449802	missense	possibly damaging	0.93
R1863:Cadps	UTSW	14	12505796	missense	probably benign	0.09
R1918:Cadps	UTSW	14	12546372	missense	probably damaging	0.99
R1920:Cadps	UTSW	14	12465859	missense	possibly damaging	0.64
R1921:Cadps	UTSW	14	12465859	missense	possibly damaging	0.64
R1922:Cadps	UTSW	14	12465859	missense	possibly damaging	0.64
R1925:Cadps	UTSW	14	12705726	missense	probably damaging	1.00
R1966:Cadps	UTSW	14	12822450	nonsense	probably null
R2013:Cadps	UTSW	14	12522337	missense	probably damaging	1.00
R2228:Cadps	UTSW	14	12465935	missense	probably benign	0.05
R2331:Cadps	UTSW	14	12603692	missense	probably damaging	1.00
R3436:Cadps	UTSW	14	12616158	splice site	probably null
R3853:Cadps	UTSW	14	12509090	splice site	probably benign
R3893:Cadps	UTSW	14	12488883	utr 3 prime	probably benign
R3916:Cadps	UTSW	14	12457702	missense	probably benign	0.00
R3917:Cadps	UTSW	14	12457702	missense	probably benign	0.00
R3953:Cadps	UTSW	14	12505937	missense	probably damaging	1.00
R3966:Cadps	UTSW	14	12522161	splice site	probably null
R4024:Cadps	UTSW	14	12705539	missense	probably damaging	1.00
R4079:Cadps	UTSW	14	12457702	missense	probably benign	0.00
R4230:Cadps	UTSW	14	12488987	missense	probably damaging	0.98
R4333:Cadps	UTSW	14	12467031	missense	probably damaging	1.00
R4410:Cadps	UTSW	14	12822323	missense	probably damaging	0.98
R4586:Cadps	UTSW	14	12505808	missense	probably damaging	1.00
R4685:Cadps	UTSW	14	12467139	missense	possibly damaging	0.77
R4698:Cadps	UTSW	14	12705654	missense	possibly damaging	0.90
R4855:Cadps	UTSW	14	12822449	missense	unknown
R4898:Cadps	UTSW	14	12411588	missense	possibly damaging	0.86
R4908:Cadps	UTSW	14	12536386	missense	probably damaging	1.00
R5208:Cadps	UTSW	14	12457711	missense	possibly damaging	0.68
R5297:Cadps	UTSW	14	12822345	missense	probably damaging	1.00
R5328:Cadps	UTSW	14	12457790	missense	probably benign	0.31
R5408:Cadps	UTSW	14	12705759	missense	possibly damaging	0.87
R5529:Cadps	UTSW	14	12454285	missense	probably damaging	1.00
R5567:Cadps	UTSW	14	12473497	missense	possibly damaging	0.49
R5570:Cadps	UTSW	14	12473497	missense	possibly damaging	0.49
R5727:Cadps	UTSW	14	12486525	nonsense	probably null
R5812:Cadps	UTSW	14	12376685	missense	probably benign
R6361:Cadps	UTSW	14	12491778	nonsense	probably null
R6767:Cadps	UTSW	14	12550888	missense	probably damaging	1.00
R6805:Cadps	UTSW	14	12467103	missense	probably damaging	0.99
R6861:Cadps	UTSW	14	12522401	nonsense	probably null
R6883:Cadps	UTSW	14	12465883	missense	probably damaging	0.96
R6887:Cadps	UTSW	14	12505811	missense	probably damaging	1.00
R6997:Cadps	UTSW	14	12505793	missense	possibly damaging	0.88
R7102:Cadps	UTSW	14	12603738	missense	probably damaging	1.00
R7120:Cadps	UTSW	14	12439919	missense	probably damaging	0.98
R7143:Cadps	UTSW	14	12491838	missense	probably benign	0.02
R7290:Cadps	UTSW	14	12616099	missense	probably damaging	1.00
R7614:Cadps	UTSW	14	12454260	missense	probably damaging	1.00
R7674:Cadps	UTSW	14	12411581	missense	probably damaging	0.99
R7715:Cadps	UTSW	14	12457762	missense	probably benign	0.01
R7801:Cadps	UTSW	14	12489476	critical splice donor site	probably null
R7915:Cadps	UTSW	14	12705544	missense	possibly damaging	0.84
R8087:Cadps	UTSW	14	12536380	missense	probably damaging	1.00
R8109:Cadps	UTSW	14	12488975	missense	probably benign	0.00
R8485:Cadps	UTSW	14	12439872	missense	probably damaging	1.00
R9156:Cadps	UTSW	14	12705676	missense	probably damaging	1.00
R9158:Cadps	UTSW	14	12546356	missense	probably benign	0.10
R9312:Cadps	UTSW	14	12616095	missense	probably damaging	1.00
R9465:Cadps	UTSW	14	12489002	missense	possibly damaging	0.93
R9519:Cadps	UTSW	14	12546290	missense	possibly damaging	0.86
X0018:Cadps	UTSW	14	12373690	missense	probably damaging	1.00
X0028:Cadps	UTSW	14	12467118	missense	possibly damaging	0.93
Z1088:Cadps	UTSW	14	12467113	missense	probably damaging	0.96
Z1177:Cadps	UTSW	14	12465880	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TAGCTACTCTCGAGAGGACTGC -3'
(R):5'- AGCACAAGAGTCCCAGGTTC -3'

Sequencing Primer
(F):5'- ACTGCCACCAGAGGACTG -3'
(R):5'- ACTGCCCTAGTGTGGACTGAG -3'

Posted On

2019-11-26