Incidental Mutation 'R7814:Olfr175-ps1'
ID601405
Institutional Source Beutler Lab
Gene Symbol Olfr175-ps1
Ensembl Gene ENSMUSG00000060663
Gene Nameolfactory receptor 175, pseudogene 1
SynonymsGA_x54KRFPKG5P-55026345-55025418, GA_x54KRFPKG5P-54993816-54992890, MOR184-1, Olfr174, MOR184-10P
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R7814 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location58823662-58826782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58824002 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 236 (K236E)
Ref Sequence ENSEMBL: ENSMUSP00000078873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079955] [ENSMUST00000215069]
Predicted Effect probably damaging
Transcript: ENSMUST00000079955
AA Change: K236E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078873
Gene: ENSMUSG00000060663
AA Change: K236E

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 305 6.8e-6 PFAM
Pfam:7tm_1 41 290 2.5e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215069
AA Change: K236E

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110065P20Rik C T 4: 124,850,602 G20R not run Het
4931409K22Rik G T 5: 24,545,422 Q626K possibly damaging Het
Adamts13 A T 2: 26,996,549 M927L probably benign Het
Akap6 T A 12: 53,140,961 N1719K probably benign Het
Ank3 G A 10: 69,986,904 V468M Het
Aox1 A G 1: 58,085,467 T956A probably benign Het
Ap4m1 T C 5: 138,174,817 V140A probably benign Het
Apc A G 18: 34,272,539 T173A probably damaging Het
Bclaf1 A G 10: 20,334,619 T839A possibly damaging Het
Btn2a2 T A 13: 23,482,806 I210F possibly damaging Het
Cadps A G 14: 12,376,706 W1269R probably damaging Het
Capn2 G C 1: 182,492,146 P159R probably damaging Het
Ccdc134 T G 15: 82,131,523 V68G probably damaging Het
Cdh26 A G 2: 178,470,035 T463A probably damaging Het
Cfap206 C T 4: 34,716,347 V373I probably benign Het
Clpx T C 9: 65,324,301 probably null Het
Ctnnd2 A T 15: 31,020,728 Y1145F probably benign Het
Ctr9 T A 7: 111,033,927 D127E probably benign Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Cyp7b1 G A 3: 18,097,302 S249L probably benign Het
D630023F18Rik T A 1: 65,116,691 D125V possibly damaging Het
Dbh A T 2: 27,174,848 Y357F probably damaging Het
Dbp T A 7: 45,706,990 L175Q probably benign Het
Dmwd A T 7: 19,080,843 T473S probably benign Het
Dnah9 T A 11: 66,005,660 Q2446L probably damaging Het
Dnmbp T C 19: 43,854,176 K498R probably benign Het
Dopey2 T A 16: 93,799,971 I1924N probably damaging Het
Dzank1 T C 2: 144,522,564 T38A probably damaging Het
Egfem1 A G 3: 29,686,791 H538R probably damaging Het
Entpd1 T C 19: 40,727,447 C353R probably damaging Het
Ephx2 C A 14: 66,110,229 C78F probably benign Het
Faf2 A T 13: 54,660,961 H388L probably benign Het
Fam186a G A 15: 99,944,664 T1233I possibly damaging Het
Gfra2 C A 14: 70,895,970 A80E probably damaging Het
Gif C A 19: 11,750,187 P125Q probably benign Het
Gm17175 T A 14: 51,574,035 probably benign Het
Gm8180 T C 14: 43,783,646 D35G possibly damaging Het
Gm884 T A 11: 103,614,173 H2323L possibly damaging Het
Gpr68 C T 12: 100,879,043 V81M probably damaging Het
Hsd3b6 A G 3: 98,810,943 L35P probably damaging Het
Hspd1 A C 1: 55,078,644 V485G possibly damaging Het
Il16 A G 7: 83,670,140 V381A possibly damaging Het
Il17rd G A 14: 27,100,117 C600Y probably benign Het
Ins2 C A 7: 142,679,586 probably benign Het
Itsn2 T C 12: 4,658,561 I872T probably benign Het
Jakmip3 A T 7: 139,019,129 D219V probably damaging Het
Jph4 T C 14: 55,109,735 T452A probably damaging Het
Kazn T C 4: 142,210,170 E12G unknown Het
Kif20b A C 19: 34,950,955 S1206R possibly damaging Het
Lca5l A G 16: 96,162,557 probably null Het
Lgals2 A T 15: 78,851,333 S60R probably benign Het
Map10 A G 8: 125,671,611 E581G probably benign Het
Map2k7 G T 8: 4,243,744 R128L probably benign Het
Mapk8 G C 14: 33,410,877 S34* probably null Het
Mcat A G 15: 83,547,909 Y253H probably damaging Het
Mmp2 T C 8: 92,850,170 L607P probably benign Het
Ncor1 A T 11: 62,333,926 V836E probably damaging Het
Neb A G 2: 52,137,380 S7113P probably damaging Het
Nphp4 T C 4: 152,524,272 F446L possibly damaging Het
Nphp4 G T 4: 152,544,403 D749Y probably damaging Het
Olfr115 T A 17: 37,610,656 T32S probably benign Het
Olfr1185-ps1 A G 2: 88,499,072 probably benign Het
Olfr338 T C 2: 36,376,809 I11T possibly damaging Het
Osbpl11 A T 16: 33,210,061 R220* probably null Het
Plrg1 G A 3: 83,056,837 V26M probably damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ppfia3 A C 7: 45,352,262 S560A probably benign Het
Ppp3cc T A 14: 70,225,015 N391I possibly damaging Het
Prdx6b T C 2: 80,292,960 S38P possibly damaging Het
Psg23 A T 7: 18,606,914 *472R probably null Het
Rapgef4 A T 2: 72,223,117 M587L probably benign Het
Rfx3 T A 19: 27,826,070 M247L probably benign Het
Rgs7 T A 1: 175,076,069 H463L probably benign Het
Riiad1 G T 3: 94,465,855 S106R probably benign Het
Rims4 A C 2: 163,918,628 I19S probably benign Het
Ros1 A T 10: 52,096,137 M1648K probably benign Het
Rrn3 T C 16: 13,811,589 F590L probably benign Het
Samd9l T A 6: 3,374,793 T823S possibly damaging Het
Sfxn1 C A 13: 54,091,231 P115Q possibly damaging Het
Slc10a7 T C 8: 78,698,573 probably null Het
Slc25a16 A T 10: 62,937,420 M142L probably benign Het
Srd5a1 ACTCCATGCTTACCCCTGGGTATTTTGTATCCAGTTTCCCTCCATGCTTACCCCTGGGTATTTTGTATCCAGTTTCCCTCCATGCTTACCCCTGGGTATTTTGTATCCAGTTTCCCTCCATGCTTACCCCTGGGTATTTTGTATCCAGTTTCCC ACTCCATGCTTACCCCTGGGTATTTTGTATCCAGTTTCCCTCCATGCTTACCCCTGGGTATTTTGTATCCAGTTTCCCTCCATGCTTACCCCTGGGTATTTTGTATCCAGTTTCCC 13: 69,594,789 probably benign Het
Stat2 CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC 10: 128,290,728 probably benign Het
Stat5a T G 11: 100,875,027 L313R probably damaging Het
Strap A G 6: 137,741,978 E176G possibly damaging Het
Tlr4 T G 4: 66,841,079 L703R probably damaging Het
Trim36 A T 18: 46,167,624 V660D possibly damaging Het
Tspoap1 T A 11: 87,775,524 D980E probably damaging Het
Usp28 T C 9: 49,003,918 V157A probably benign Het
Vmn2r17 A T 5: 109,427,873 R203S probably benign Het
Vmn2r66 T C 7: 85,007,264 I181M probably benign Het
Zan T A 5: 137,463,579 T1113S unknown Het
Zfp442 C T 2: 150,409,482 D167N possibly damaging Het
Other mutations in Olfr175-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Olfr175-ps1 APN 16 58824595 missense probably damaging 1.00
IGL01404:Olfr175-ps1 APN 16 58824595 missense probably damaging 1.00
IGL01867:Olfr175-ps1 APN 16 58823974 missense probably damaging 1.00
IGL02073:Olfr175-ps1 APN 16 58823806 missense probably benign
IGL02393:Olfr175-ps1 APN 16 58824046 missense probably damaging 0.99
IGL02474:Olfr175-ps1 APN 16 58824656 missense probably benign
IGL02548:Olfr175-ps1 APN 16 58824328 missense probably benign 0.42
IGL02948:Olfr175-ps1 APN 16 58824088 missense probably benign 0.00
PIT4504001:Olfr175-ps1 UTSW 16 58824308 missense probably benign 0.00
R0553:Olfr175-ps1 UTSW 16 58824155 missense probably damaging 0.99
R1191:Olfr175-ps1 UTSW 16 58824559 missense probably benign
R1201:Olfr175-ps1 UTSW 16 58823863 missense probably damaging 0.98
R1458:Olfr175-ps1 UTSW 16 58824676 missense probably null 0.68
R1469:Olfr175-ps1 UTSW 16 58824610 missense probably benign
R1469:Olfr175-ps1 UTSW 16 58824610 missense probably benign
R1843:Olfr175-ps1 UTSW 16 58824077 missense probably damaging 0.99
R2147:Olfr175-ps1 UTSW 16 58824479 missense probably damaging 0.99
R2421:Olfr175-ps1 UTSW 16 58824346 missense probably damaging 1.00
R4370:Olfr175-ps1 UTSW 16 58824593 missense probably benign 0.00
R4621:Olfr175-ps1 UTSW 16 58824106 missense possibly damaging 0.94
R4622:Olfr175-ps1 UTSW 16 58824106 missense possibly damaging 0.94
R4623:Olfr175-ps1 UTSW 16 58824106 missense possibly damaging 0.94
R4711:Olfr175-ps1 UTSW 16 58824706 start codon destroyed probably null 0.98
R5323:Olfr175-ps1 UTSW 16 58824703 missense probably benign
R5447:Olfr175-ps1 UTSW 16 58824483 nonsense probably null
R5457:Olfr175-ps1 UTSW 16 58824433 missense probably damaging 0.97
R5546:Olfr175-ps1 UTSW 16 58824153 nonsense probably null
R5623:Olfr175-ps1 UTSW 16 58824343 missense probably benign 0.02
R5767:Olfr175-ps1 UTSW 16 58823953 missense probably benign 0.42
R6270:Olfr175-ps1 UTSW 16 58824419 missense probably damaging 1.00
R6449:Olfr175-ps1 UTSW 16 58824526 missense probably damaging 1.00
R7356:Olfr175-ps1 UTSW 16 58824355 missense probably damaging 0.99
R7521:Olfr175-ps1 UTSW 16 58823894 missense probably benign 0.00
R7638:Olfr175-ps1 UTSW 16 58824595 missense probably damaging 1.00
X0011:Olfr175-ps1 UTSW 16 58824663 missense probably benign
Z1176:Olfr175-ps1 UTSW 16 58824307 frame shift probably null
Z1177:Olfr175-ps1 UTSW 16 58824698 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- CTAGTGGAAATAAATTGTCCAAGGG -3'
(R):5'- TGCAGGTCTCATGTGATCAAGC -3'

Sequencing Primer
(F):5'- CCTTTGTTCATGGTTCTTTTAATTGC -3'
(R):5'- AGGTCTCATGTGATCAAGCACTTC -3'
Posted On2019-11-26