Incidental Mutation 'R7814:Dnmbp'
ID 601415
Institutional Source Beutler Lab
Gene Symbol Dnmbp
Ensembl Gene ENSMUSG00000025195
Gene Name dynamin binding protein
Synonyms 2410003M15Rik, 2410003L07Rik, Tuba
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7814 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 43846821-43940191 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43854176 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 498 (K498R)
Ref Sequence ENSEMBL: ENSMUSP00000148421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026209] [ENSMUST00000212032] [ENSMUST00000212048] [ENSMUST00000212396] [ENSMUST00000212592]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000026209
AA Change: K1255R

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000026209
Gene: ENSMUSG00000025195
AA Change: K1255R

DomainStartEndE-ValueType
SH3 5 60 6.75e-14 SMART
SH3 69 126 3.33e-4 SMART
SH3 149 204 6.85e-15 SMART
SH3 247 302 8.43e-15 SMART
low complexity region 601 619 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
coiled coil region 694 755 N/A INTRINSIC
low complexity region 756 764 N/A INTRINSIC
RhoGEF 787 969 4.84e-39 SMART
BAR 999 1213 6.21e-55 SMART
SH3 1291 1350 4.62e-1 SMART
low complexity region 1354 1374 N/A INTRINSIC
SH3 1519 1578 1.08e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212032
AA Change: K1251R

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212048
AA Change: K939R

PolyPhen 2 Score 0.723 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000212396
AA Change: K1255R

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000212592
AA Change: K498R

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: This gene encodes a member of the DBL family of guanine nucleotide exchange factors. The encoded protein has been proposed to regulate the actin cytoskeleton by specifically activating the Rho-family GTPase Cdc42. An interaction between the encoded protein and a Listeria protein has been shown to mediate Listeria infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110065P20Rik C T 4: 124,850,602 G20R not run Het
4931409K22Rik G T 5: 24,545,422 Q626K possibly damaging Het
Adamts13 A T 2: 26,996,549 M927L probably benign Het
Akap6 T A 12: 53,140,961 N1719K probably benign Het
Ank3 G A 10: 69,986,904 V468M Het
Aox1 A G 1: 58,085,467 T956A probably benign Het
Ap4m1 T C 5: 138,174,817 V140A probably benign Het
Apc A G 18: 34,272,539 T173A probably damaging Het
Bclaf1 A G 10: 20,334,619 T839A possibly damaging Het
Btn2a2 T A 13: 23,482,806 I210F possibly damaging Het
Cadps A G 14: 12,376,706 W1269R probably damaging Het
Capn2 G C 1: 182,492,146 P159R probably damaging Het
Ccdc134 T G 15: 82,131,523 V68G probably damaging Het
Cdh26 A G 2: 178,470,035 T463A probably damaging Het
Cfap206 C T 4: 34,716,347 V373I probably benign Het
Clpx T C 9: 65,324,301 probably null Het
Ctnnd2 A T 15: 31,020,728 Y1145F probably benign Het
Ctr9 T A 7: 111,033,927 D127E probably benign Het
Cyp2f2 G A 7: 27,129,253 V183I probably benign Het
Cyp7b1 G A 3: 18,097,302 S249L probably benign Het
D630023F18Rik T A 1: 65,116,691 D125V possibly damaging Het
Dbh A T 2: 27,174,848 Y357F probably damaging Het
Dbp T A 7: 45,706,990 L175Q probably benign Het
Dmwd A T 7: 19,080,843 T473S probably benign Het
Dnah9 T A 11: 66,005,660 Q2446L probably damaging Het
Dopey2 T A 16: 93,799,971 I1924N probably damaging Het
Dsg1a T A 18: 20,338,515 probably null Het
Dzank1 T C 2: 144,522,564 T38A probably damaging Het
Egfem1 A G 3: 29,686,791 H538R probably damaging Het
Entpd1 T C 19: 40,727,447 C353R probably damaging Het
Ephx2 C A 14: 66,110,229 C78F probably benign Het
Faf2 A T 13: 54,660,961 H388L probably benign Het
Fam186a G A 15: 99,944,664 T1233I possibly damaging Het
Gfra2 C A 14: 70,895,970 A80E probably damaging Het
Gif C A 19: 11,750,187 P125Q probably benign Het
Gm17175 T A 14: 51,574,035 probably benign Het
Gm8180 T C 14: 43,783,646 D35G possibly damaging Het
Gm884 T A 11: 103,614,173 H2323L possibly damaging Het
Gpr68 C T 12: 100,879,043 V81M probably damaging Het
Hsd3b6 A G 3: 98,810,943 L35P probably damaging Het
Hspd1 A C 1: 55,078,644 V485G possibly damaging Het
Il16 A G 7: 83,670,140 V381A possibly damaging Het
Il17rd G A 14: 27,100,117 C600Y probably benign Het
Ins2 C A 7: 142,679,586 probably benign Het
Itsn2 T C 12: 4,658,561 I872T probably benign Het
Jakmip3 A T 7: 139,019,129 D219V probably damaging Het
Jph4 T C 14: 55,109,735 T452A probably damaging Het
Kazn T C 4: 142,210,170 E12G unknown Het
Kif20b A C 19: 34,950,955 S1206R possibly damaging Het
Lca5l A G 16: 96,162,557 probably null Het
Lgals2 A T 15: 78,851,333 S60R probably benign Het
Map10 A G 8: 125,671,611 E581G probably benign Het
Map2k7 G T 8: 4,243,744 R128L probably benign Het
Mapk8 G C 14: 33,410,877 S34* probably null Het
Mcat A G 15: 83,547,909 Y253H probably damaging Het
Mmp2 T C 8: 92,850,170 L607P probably benign Het
Ncor1 A T 11: 62,333,926 V836E probably damaging Het
Neb A G 2: 52,137,380 S7113P probably damaging Het
Nphp4 T C 4: 152,524,272 F446L possibly damaging Het
Nphp4 G T 4: 152,544,403 D749Y probably damaging Het
Olfr115 T A 17: 37,610,656 T32S probably benign Het
Olfr1185-ps1 A G 2: 88,499,072 probably benign Het
Olfr175-ps1 T C 16: 58,824,002 K236E probably damaging Het
Olfr338 T C 2: 36,376,809 I11T possibly damaging Het
Osbpl11 A T 16: 33,210,061 R220* probably null Het
Plrg1 G A 3: 83,056,837 V26M probably damaging Het
Polr1b C A 2: 129,125,544 F952L probably damaging Het
Ppfia3 A C 7: 45,352,262 S560A probably benign Het
Ppp3cc T A 14: 70,225,015 N391I possibly damaging Het
Prdx6b T C 2: 80,292,960 S38P possibly damaging Het
Psg23 A T 7: 18,606,914 *472R probably null Het
Rapgef4 A T 2: 72,223,117 M587L probably benign Het
Rfx3 T A 19: 27,826,070 M247L probably benign Het
Rgs7 T A 1: 175,076,069 H463L probably benign Het
Riiad1 G T 3: 94,465,855 S106R probably benign Het
Rims4 A C 2: 163,918,628 I19S probably benign Het
Ros1 A T 10: 52,096,137 M1648K probably benign Het
Rrn3 T C 16: 13,811,589 F590L probably benign Het
Samd9l T A 6: 3,374,793 T823S possibly damaging Het
Sfxn1 C A 13: 54,091,231 P115Q possibly damaging Het
Slc10a7 T C 8: 78,698,573 probably null Het
Slc25a16 A T 10: 62,937,420 M142L probably benign Het
Stat2 CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC 10: 128,290,728 probably benign Het
Stat5a T G 11: 100,875,027 L313R probably damaging Het
Strap A G 6: 137,741,978 E176G possibly damaging Het
Tlr4 T G 4: 66,841,079 L703R probably damaging Het
Trim36 A T 18: 46,167,624 V660D possibly damaging Het
Tspoap1 T A 11: 87,775,524 D980E probably damaging Het
Usp28 T C 9: 49,003,918 V157A probably benign Het
Vmn2r17 A T 5: 109,427,873 R203S probably benign Het
Vmn2r66 T C 7: 85,007,264 I181M probably benign Het
Zan T A 5: 137,463,579 T1113S unknown Het
Zfp442 C T 2: 150,409,482 D167N possibly damaging Het
Other mutations in Dnmbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Dnmbp APN 19 43902479 missense probably damaging 1.00
IGL01301:Dnmbp APN 19 43902354 missense probably benign 0.04
IGL01443:Dnmbp APN 19 43902870 missense probably damaging 1.00
IGL01569:Dnmbp APN 19 43874856 missense probably benign 0.14
IGL01818:Dnmbp APN 19 43901165 missense probably damaging 1.00
IGL01989:Dnmbp APN 19 43867555 missense probably damaging 1.00
IGL02111:Dnmbp APN 19 43867555 missense probably damaging 1.00
IGL02666:Dnmbp APN 19 43854127 splice site probably benign
IGL02736:Dnmbp APN 19 43849770 splice site probably benign
ANU18:Dnmbp UTSW 19 43902354 missense probably benign 0.04
R0013:Dnmbp UTSW 19 43902231 missense probably benign 0.00
R0013:Dnmbp UTSW 19 43902231 missense probably benign 0.00
R0032:Dnmbp UTSW 19 43902719 missense probably damaging 1.00
R0032:Dnmbp UTSW 19 43902719 missense probably damaging 1.00
R0101:Dnmbp UTSW 19 43874160 missense possibly damaging 0.94
R0129:Dnmbp UTSW 19 43850027 missense probably benign 0.03
R0288:Dnmbp UTSW 19 43902459 missense possibly damaging 0.77
R0322:Dnmbp UTSW 19 43854846 missense probably damaging 1.00
R0426:Dnmbp UTSW 19 43852436 splice site probably benign
R0432:Dnmbp UTSW 19 43854857 nonsense probably null
R0497:Dnmbp UTSW 19 43856640 splice site probably benign
R1306:Dnmbp UTSW 19 43901779 missense probably benign 0.00
R1765:Dnmbp UTSW 19 43902140 missense possibly damaging 0.61
R1800:Dnmbp UTSW 19 43901720 missense probably benign 0.00
R1846:Dnmbp UTSW 19 43902747 missense probably damaging 1.00
R1916:Dnmbp UTSW 19 43901568 missense possibly damaging 0.85
R2001:Dnmbp UTSW 19 43850173 missense possibly damaging 0.76
R2131:Dnmbp UTSW 19 43854311 missense probably damaging 1.00
R2156:Dnmbp UTSW 19 43901907 missense possibly damaging 0.95
R2238:Dnmbp UTSW 19 43868864 missense possibly damaging 0.90
R2372:Dnmbp UTSW 19 43902320 missense probably benign 0.01
R4817:Dnmbp UTSW 19 43849972 missense probably benign 0.05
R5093:Dnmbp UTSW 19 43849876 missense probably damaging 0.98
R5249:Dnmbp UTSW 19 43902440 missense probably damaging 0.98
R5970:Dnmbp UTSW 19 43854171 missense probably benign 0.28
R6168:Dnmbp UTSW 19 43850240 missense probably damaging 1.00
R6189:Dnmbp UTSW 19 43890309 missense probably benign 0.00
R6189:Dnmbp UTSW 19 43901511 missense probably benign 0.05
R6239:Dnmbp UTSW 19 43848185 missense probably benign 0.11
R6256:Dnmbp UTSW 19 43852281 missense probably damaging 1.00
R6461:Dnmbp UTSW 19 43867525 critical splice donor site probably null
R6599:Dnmbp UTSW 19 43856586 missense probably damaging 0.96
R6704:Dnmbp UTSW 19 43901213 missense probably damaging 1.00
R7350:Dnmbp UTSW 19 43901505 missense probably damaging 1.00
R7355:Dnmbp UTSW 19 43901741 missense probably benign
R7409:Dnmbp UTSW 19 43890557 missense unknown
R7548:Dnmbp UTSW 19 43889399 missense probably benign 0.40
R7755:Dnmbp UTSW 19 43850086 missense probably benign
R7954:Dnmbp UTSW 19 43902303 missense probably benign
R7955:Dnmbp UTSW 19 43902323 missense probably benign 0.01
R8282:Dnmbp UTSW 19 43890566 missense unknown
R8385:Dnmbp UTSW 19 43889651 missense probably benign 0.01
R8696:Dnmbp UTSW 19 43874223 missense probably damaging 1.00
R8738:Dnmbp UTSW 19 43912238 missense probably damaging 0.98
R8819:Dnmbp UTSW 19 43901415 missense probably benign 0.43
R8824:Dnmbp UTSW 19 43849837 missense probably benign
R8902:Dnmbp UTSW 19 43901786 missense probably benign 0.00
R8906:Dnmbp UTSW 19 43890242 missense probably benign 0.01
R8977:Dnmbp UTSW 19 43852312 missense probably damaging 1.00
R9628:Dnmbp UTSW 19 43870207 missense probably damaging 0.99
R9635:Dnmbp UTSW 19 43867535 missense probably benign 0.39
R9771:Dnmbp UTSW 19 43866592 missense probably damaging 0.96
Z1088:Dnmbp UTSW 19 43874984 missense probably benign 0.01
Z1088:Dnmbp UTSW 19 43902122 missense probably benign 0.00
Z1176:Dnmbp UTSW 19 43866688 missense probably damaging 0.99
Z1176:Dnmbp UTSW 19 43889367 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AGAAGCACAGCAGCTGTTC -3'
(R):5'- CTCTAAAGACTTGGGCCAGG -3'

Sequencing Primer
(F):5'- CATGGTGCTCACGTGCTG -3'
(R):5'- CCAGGGGTCCTTCATCTGTG -3'
Posted On 2019-11-26