Mutagenetix > Incidental Mutation

Incidental Mutation 'R7381:Sis'

601416

Institutional Source

Beutler Lab

Gene Symbol

Sis

Ensembl Gene

ENSMUSG00000027790

Gene Name

sucrase isomaltase (alpha-glucosidase)

Synonyms

Si-s, sucrase-isomaltase

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7381 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

72888557-72967863 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 72913292 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000129116 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094190] [ENSMUST00000167334]

AlphaFold

F8VQM5

Predicted Effect

probably null
Transcript: ENSMUST00000094190

SMART Domains

Protein: ENSMUSP00000091742
Gene: ENSMUSG00000027790

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
PD	51	103	1.92e-12	SMART
Pfam:NtCtMGAM_N	115	224	1.2e-35	PFAM
Pfam:Gal_mutarotas_2	225	294	4.8e-9	PFAM
Pfam:Glyco_hydro_31	314	787	2.1e-142	PFAM
PD	917	972	6.69e-12	SMART
Pfam:NtCtMGAM_N	985	1098	6e-33	PFAM
Blast:ANK	1138	1168	1e-5	BLAST
Pfam:Glyco_hydro_31	1186	1682	8.4e-137	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000167334

SMART Domains

Protein: ENSMUSP00000129116
Gene: ENSMUSG00000027790

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
PD	51	103	1.92e-12	SMART
Pfam:NtCtMGAM_N	115	224	1.2e-35	PFAM
Pfam:Gal_mutarotas_2	225	294	4.8e-9	PFAM
Pfam:Glyco_hydro_31	314	787	2.1e-142	PFAM
PD	917	972	6.69e-12	SMART
Pfam:NtCtMGAM_N	985	1098	6e-33	PFAM
Blast:ANK	1138	1168	1e-5	BLAST
Pfam:Glyco_hydro_31	1186	1682	8.4e-137	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

98% (88/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sucrase-isomaltase enzyme that is expressed in the intestinal brush border. The encoded protein is synthesized as a precursor protein that is cleaved by pancreatic proteases into two enzymatic subunits sucrase and isomaltase. These two subunits heterodimerize to form the sucrose-isomaltase complex. This complex is essential for the digestion of dietary carbohydrates including starch, sucrose and isomaltose. Mutations in this gene are the cause of congenital sucrase-isomaltase deficiency.[provided by RefSeq, Apr 2010]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016K19Rik	A	T	11: 76,003,007	D70V	probably damaging	Het
4930550C14Rik	T	C	9: 53,411,822	Y53H	probably damaging	Het
Abca8a	A	T	11: 110,030,087		probably null	Het
Acads	C	A	5: 115,110,998	Q365H	probably damaging	Het
Acsm3	A	G	7: 119,780,826	D462G	probably damaging	Het
Adam39	T	A	8: 40,825,963	C464S	probably damaging	Het
Adgra3	A	G	5: 50,058,774	M1T	probably null	Het
AI182371	T	C	2: 35,085,359	Y276C	probably damaging	Het
Ank2	T	A	3: 126,936,628	H719L	possibly damaging	Het
Ano7	G	A	1: 93,395,335	V466I	probably benign	Het
Art5	A	G	7: 102,098,170	L134P	probably damaging	Het
Atcay	A	G	10: 81,210,597	Y298H	possibly damaging	Het
Atp1a4	A	T	1: 172,240,115	F527Y	possibly damaging	Het
Bpifb2	A	T	2: 153,892,348	M428L	probably benign	Het
Brinp2	A	C	1: 158,246,343	V736G	probably benign	Het
Cdc5l	C	T	17: 45,411,923	A437T	probably benign	Het
Cdx2	G	A	5: 147,306,630	P118L	possibly damaging	Het
Chpt1	G	A	10: 88,475,331		probably null	Het
Creb3l2	T	A	6: 37,335,848	E417V	probably damaging	Het
Csnk2a1	A	G	2: 152,258,694	T129A	probably benign	Het
Dennd6b	A	T	15: 89,186,173	L431Q	possibly damaging	Het
Dgkz	C	T	2: 91,944,835	A260T	probably benign	Het
Dhx34	T	A	7: 16,215,448	T352S	probably benign	Het
Elp4	C	T	2: 105,792,307	R349Q	not run	Het
Emsy	A	C	7: 98,590,803	F1228V	probably damaging	Het
Eps8l1	T	A	7: 4,470,438		probably null	Het
Faf1	T	A	4: 109,861,937	D413E	probably damaging	Het
Fam71e2	C	A	7: 4,757,682	R677L		Het
Fat3	T	C	9: 16,246,987	Y1109C	probably damaging	Het
Fbp1	T	C	13: 62,865,053	K314E	probably benign	Het
Fbxl20	A	G	11: 98,090,788	V358A	probably benign	Het
Fbxo34	C	G	14: 47,530,535	R502G	probably benign	Het
Fxr2	G	A	11: 69,642,049	C151Y	possibly damaging	Het
Gja8	T	C	3: 96,920,022	D108G	probably benign	Het
Gm10722	C	A	9: 3,001,235	L104I	probably benign	Het
Grsf1	A	G	5: 88,665,807	V361A	probably benign	Het
Gsap	T	A	5: 21,226,787	I228N	probably damaging	Het
Hagh	T	C	17: 24,856,712	I131T	probably damaging	Het
Heca	A	T	10: 17,915,524	Y261*	probably null	Het
Hipk3	A	G	2: 104,439,351	F498L	probably damaging	Het
Hps4	T	A	5: 112,375,458	I614N	possibly damaging	Het
Icam1	T	C	9: 21,027,590	S450P	probably benign	Het
Il22	G	A	10: 118,205,164	M58I	possibly damaging	Het
Khdrbs2	T	A	1: 32,333,802	S186T	not run	Het
Kif16b	A	G	2: 142,857,423	F79S	probably damaging	Het
Kntc1	C	A	5: 123,810,908	F1905L	probably benign	Het
Lrp1b	C	T	2: 40,802,917	G3423D		Het
Lrp5	G	T	19: 3,593,588	Q1346K	probably benign	Het
Map3k21	A	C	8: 125,944,978	T1002P	possibly damaging	Het
Mdga2	G	T	12: 66,568,896	R646S	probably benign	Het
Mex3b	G	T	7: 82,868,865	M129I	possibly damaging	Het
Mfsd10	G	T	5: 34,636,426	N85K	probably damaging	Het
Mios	A	G	6: 8,216,064	D420G	probably damaging	Het
Mogs	C	A	6: 83,115,632	P18T	unknown	Het
Mrgpre	A	G	7: 143,781,413	C118R	probably damaging	Het
Muc4	A	T	16: 32,780,915	H1321L		Het
Nkapl	T	C	13: 21,467,589	K285E	probably damaging	Het
Nphp4	C	T	4: 152,499,003	P200S	possibly damaging	Het
Piezo1	A	G	8: 122,501,658	F297L		Het
Pkhd1	T	G	1: 20,200,973	S3119R	probably damaging	Het
Pla2g15	G	A	8: 106,162,944	V283I	probably benign	Het
Ppp1r13l	T	A	7: 19,368,861		probably null	Het
Prex1	A	G	2: 166,587,127	Y849H	probably damaging	Het
Psg27	C	A	7: 18,567,083	W15L	probably benign	Het
Ptar1	A	T	19: 23,708,970		probably null	Het
Ptpn6	G	A	6: 124,728,172	R264C	probably damaging	Het
Ptprb	A	G	10: 116,341,133	I988V	probably benign	Het
Ptpro	G	A	6: 137,399,561	V680I	possibly damaging	Het
Rnf170	C	T	8: 26,123,848	P28S	probably benign	Het
Rnpepl1	A	G	1: 92,919,195	S580G	possibly damaging	Het
Rtel1	C	T	2: 181,330,815	R29*	probably null	Het
Rtkn	T	C	6: 83,151,745	L26P	probably damaging	Het
Sdk2	A	C	11: 113,838,489	S1087R	probably damaging	Het
Sema7a	C	T	9: 57,953,569	P71L	probably benign	Het
Sgpp1	C	T	12: 75,716,264	C381Y	probably damaging	Het
Slc24a5	A	C	2: 125,068,949	D100A	probably benign	Het
Slc25a23	A	T	17: 57,053,587	I251K	probably damaging	Het
Slc6a5	T	A	7: 49,930,056	L394H	probably damaging	Het
Slc7a4	A	T	16: 17,575,056	M293K	probably damaging	Het
Syne2	T	A	12: 75,926,489	S1089T	probably benign	Het
Tanc1	A	T	2: 59,785,326	T226S	probably damaging	Het
Tdrd6	T	C	17: 43,626,093	T1355A	probably benign	Het
Tmem101	A	G	11: 102,153,350	M237T	possibly damaging	Het
Ttn	G	A	2: 76,919,015	H3897Y	possibly damaging	Het
Tubb4a	C	T	17: 57,080,698	V443M	unknown	Het
Ucp2	G	A	7: 100,498,369	R185H	possibly damaging	Het
Vmn1r116	G	T	7: 20,872,511	E86*	probably null	Het
Vmn2r37	T	C	7: 9,210,033	E530G	probably benign	Het
Vwa8	A	G	14: 79,095,685	T1293A	probably benign	Het
Zfc3h1	T	A	10: 115,424,630	Y1711N	probably benign	Het
Zfp873	A	T	10: 82,060,971	E512V	probably damaging	Het
Zfyve16	T	A	13: 92,521,146	K752N	probably damaging	Het
Zhx1	T	C	15: 58,053,165	N562D	possibly damaging	Het

Other mutations in Sis

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Sis	APN	3	72946636	missense	probably benign
IGL00715:Sis	APN	3	72934124	missense	probably damaging	1.00
IGL00721:Sis	APN	3	72943579	missense	probably damaging	1.00
IGL00766:Sis	APN	3	72907237	splice site	probably benign
IGL00783:Sis	APN	3	72946632	missense	probably benign
IGL00805:Sis	APN	3	72934199	missense	probably benign	0.05
IGL00932:Sis	APN	3	72940956	splice site	probably benign
IGL01020:Sis	APN	3	72966838	missense	probably damaging	1.00
IGL01024:Sis	APN	3	72911876	missense	probably damaging	1.00
IGL01286:Sis	APN	3	72941025	missense	probably damaging	1.00
IGL01457:Sis	APN	3	72961021	missense	probably benign
IGL01514:Sis	APN	3	72935920	splice site	probably benign
IGL01986:Sis	APN	3	72945212	missense	probably damaging	1.00
IGL02110:Sis	APN	3	72928699	nonsense	probably null
IGL02132:Sis	APN	3	72947471	missense	probably benign	0.00
IGL02152:Sis	APN	3	72888986	utr 3 prime	probably benign
IGL02200:Sis	APN	3	72943604	missense	probably damaging	0.99
IGL02244:Sis	APN	3	72956190	missense	probably benign	0.19
IGL02307:Sis	APN	3	72911834	splice site	probably benign
IGL02374:Sis	APN	3	72925456	missense	probably benign	0.03
IGL02437:Sis	APN	3	72919614	critical splice acceptor site	probably null
IGL02571:Sis	APN	3	72956304	splice site	probably benign
IGL02601:Sis	APN	3	72913210	missense	probably benign	0.44
IGL03063:Sis	APN	3	72928297	missense	probably benign
IGL03382:Sis	APN	3	72928719	missense	probably benign	0.00
IGL03397:Sis	APN	3	72935879	missense	probably benign	0.44
PIT1430001:Sis	UTSW	3	72922829	missense	probably damaging	0.97
R0013:Sis	UTSW	3	72910476	missense	possibly damaging	0.65
R0013:Sis	UTSW	3	72910476	missense	possibly damaging	0.65
R0046:Sis	UTSW	3	72932094	missense	probably benign	0.01
R0094:Sis	UTSW	3	72921437	missense	probably damaging	1.00
R0096:Sis	UTSW	3	72928267	missense	probably damaging	1.00
R0505:Sis	UTSW	3	72960296	missense	probably benign	0.29
R0544:Sis	UTSW	3	72951642	missense	probably damaging	1.00
R0551:Sis	UTSW	3	72925407	missense	possibly damaging	0.79
R0617:Sis	UTSW	3	72965605	missense	probably damaging	1.00
R0698:Sis	UTSW	3	72910498	missense	probably damaging	1.00
R0701:Sis	UTSW	3	72941045	missense	probably damaging	1.00
R0704:Sis	UTSW	3	72949822	missense	possibly damaging	0.63
R0706:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0710:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0752:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0753:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0754:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0767:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0769:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0772:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0774:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0776:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0818:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0819:Sis	UTSW	3	72952531	missense	probably damaging	1.00
R0885:Sis	UTSW	3	72911949	nonsense	probably null
R1076:Sis	UTSW	3	72934098	missense	probably damaging	0.97
R1140:Sis	UTSW	3	72951616	missense	probably damaging	0.98
R1175:Sis	UTSW	3	72958104	splice site	probably benign
R1301:Sis	UTSW	3	72946582	missense	possibly damaging	0.76
R1437:Sis	UTSW	3	72934142	missense	probably damaging	1.00
R1466:Sis	UTSW	3	72932060	missense	possibly damaging	0.60
R1466:Sis	UTSW	3	72932060	missense	possibly damaging	0.60
R1472:Sis	UTSW	3	72889027	missense	probably benign	0.12
R1584:Sis	UTSW	3	72932060	missense	possibly damaging	0.60
R1707:Sis	UTSW	3	72909087	splice site	probably benign
R1715:Sis	UTSW	3	72889010	missense	possibly damaging	0.47
R1719:Sis	UTSW	3	72965604	missense	probably damaging	1.00
R1728:Sis	UTSW	3	72965645	nonsense	probably null
R1784:Sis	UTSW	3	72965645	nonsense	probably null
R1820:Sis	UTSW	3	72921142	missense	probably damaging	1.00
R1972:Sis	UTSW	3	72921004	missense	probably damaging	1.00
R1973:Sis	UTSW	3	72921004	missense	probably damaging	1.00
R2054:Sis	UTSW	3	72913237	missense	probably benign	0.01
R2233:Sis	UTSW	3	72913194	missense	probably benign	0.03
R2235:Sis	UTSW	3	72913194	missense	probably benign	0.03
R2276:Sis	UTSW	3	72914601	nonsense	probably null
R2435:Sis	UTSW	3	72911904	missense	probably benign	0.01
R2885:Sis	UTSW	3	72909173	missense	probably benign	0.01
R2966:Sis	UTSW	3	72889010	missense	probably benign	0.30
R3708:Sis	UTSW	3	72943523	missense	probably benign	0.02
R3790:Sis	UTSW	3	72921414	missense	probably damaging	1.00
R3807:Sis	UTSW	3	72925596	missense	probably benign	0.01
R3858:Sis	UTSW	3	72928652	missense	probably damaging	0.99
R3974:Sis	UTSW	3	72943635	missense	probably damaging	0.96
R3975:Sis	UTSW	3	72943635	missense	probably damaging	0.96
R4037:Sis	UTSW	3	72928602	missense	probably benign
R4080:Sis	UTSW	3	72921184	missense	probably damaging	1.00
R4204:Sis	UTSW	3	72961082	missense	probably benign
R4394:Sis	UTSW	3	72956149	missense	probably damaging	1.00
R4470:Sis	UTSW	3	72928159	splice site	probably null
R4573:Sis	UTSW	3	72928237	missense	possibly damaging	0.94
R4868:Sis	UTSW	3	72943548	missense	probably benign	0.09
R5023:Sis	UTSW	3	72934122	missense	probably benign	0.05
R5264:Sis	UTSW	3	72949756	missense	probably damaging	0.98
R5414:Sis	UTSW	3	72952493	missense	probably benign
R5462:Sis	UTSW	3	72949838	missense	probably damaging	0.96
R5523:Sis	UTSW	3	72891421	missense	probably benign	0.00
R5584:Sis	UTSW	3	72910415	missense	probably damaging	1.00
R5587:Sis	UTSW	3	72914576	missense	possibly damaging	0.94
R5725:Sis	UTSW	3	72965598	missense	probably damaging	1.00
R5769:Sis	UTSW	3	72928235	missense	probably damaging	0.98
R5790:Sis	UTSW	3	72928174	missense	probably benign
R5864:Sis	UTSW	3	72949818	missense	probably damaging	1.00
R5902:Sis	UTSW	3	72960256	critical splice donor site	probably null
R5925:Sis	UTSW	3	72921380	splice site	probably null
R6018:Sis	UTSW	3	72913192	missense	possibly damaging	0.95
R6029:Sis	UTSW	3	72928308	missense	probably benign	0.30
R6124:Sis	UTSW	3	72953211	missense	possibly damaging	0.69
R6171:Sis	UTSW	3	72961027	missense	possibly damaging	0.75
R6182:Sis	UTSW	3	72904293	missense	probably benign	0.05
R6295:Sis	UTSW	3	72966770	missense	probably damaging	0.99
R6416:Sis	UTSW	3	72911854	missense	probably damaging	1.00
R6431:Sis	UTSW	3	72958174	missense	probably benign	0.00
R6472:Sis	UTSW	3	72938734	nonsense	probably null
R6517:Sis	UTSW	3	72907142	missense	probably damaging	1.00
R6701:Sis	UTSW	3	72949527	missense	probably damaging	1.00
R6796:Sis	UTSW	3	72965618	missense	probably benign	0.06
R6853:Sis	UTSW	3	72891426	missense	possibly damaging	0.93
R6906:Sis	UTSW	3	72919485	missense	probably damaging	1.00
R7058:Sis	UTSW	3	72903607	missense	probably damaging	0.98
R7357:Sis	UTSW	3	72925071	missense	probably damaging	1.00
R7439:Sis	UTSW	3	72909041	missense	possibly damaging	0.81
R7742:Sis	UTSW	3	72925098	missense	probably benign	0.19
R7813:Sis	UTSW	3	72925468	missense	probably benign	0.01
R7883:Sis	UTSW	3	72920996	missense	possibly damaging	0.78
R7899:Sis	UTSW	3	72937251	missense	probably damaging	1.00
R7915:Sis	UTSW	3	72921138	missense	probably damaging	0.99
R7985:Sis	UTSW	3	72936961	splice site	probably null
R8020:Sis	UTSW	3	72908965	critical splice donor site	probably null
R8023:Sis	UTSW	3	72952480	missense	probably damaging	0.97
R8029:Sis	UTSW	3	72921142	missense	probably damaging	1.00
R8053:Sis	UTSW	3	72949568	nonsense	probably null
R8062:Sis	UTSW	3	72920988	nonsense	probably null
R8074:Sis	UTSW	3	72917198	missense	probably damaging	1.00
R8085:Sis	UTSW	3	72907129	missense	probably damaging	1.00
R8137:Sis	UTSW	3	72889045	missense	probably benign	0.22
R8349:Sis	UTSW	3	72903651	missense	probably damaging	1.00
R8354:Sis	UTSW	3	72947501	missense	possibly damaging	0.84
R8366:Sis	UTSW	3	72958233	missense	probably damaging	1.00
R8449:Sis	UTSW	3	72903651	missense	probably damaging	1.00
R8454:Sis	UTSW	3	72947501	missense	possibly damaging	0.84
R8474:Sis	UTSW	3	72929397	missense	probably damaging	1.00
R8515:Sis	UTSW	3	72929409	missense	probably benign	0.00
R8680:Sis	UTSW	3	72960295	missense	probably damaging	1.00
R8703:Sis	UTSW	3	72960324	missense	probably damaging	1.00
R9098:Sis	UTSW	3	72937245	missense	possibly damaging	0.66
R9466:Sis	UTSW	3	72965577	critical splice donor site	probably null
R9574:Sis	UTSW	3	72921157	missense	probably benign	0.05
R9630:Sis	UTSW	3	72921389	missense	probably benign	0.11
R9680:Sis	UTSW	3	72956288	missense	probably benign	0.12
R9709:Sis	UTSW	3	72891741	missense	possibly damaging	0.47
R9731:Sis	UTSW	3	72928210	missense	probably benign	0.01
X0009:Sis	UTSW	3	72889022	missense	probably damaging	0.99
X0024:Sis	UTSW	3	72928670	missense	probably benign
X0060:Sis	UTSW	3	72920906	intron	probably benign
Z1176:Sis	UTSW	3	72904273	missense	probably benign	0.05
Z1176:Sis	UTSW	3	72943557	missense	probably benign	0.25
Z1177:Sis	UTSW	3	72909172	missense	possibly damaging	0.88
Z1177:Sis	UTSW	3	72910474	missense	probably damaging	1.00
Z1177:Sis	UTSW	3	72943569	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATATTGGTCTGTGTGACTGAC -3'
(R):5'- GCTAAGTAAGGCGTTTTAATGGACTG -3'

Sequencing Primer
(F):5'- ATATTGGTCTGTGTGACTGACTATTG -3'
(R):5'- CTTCCCAATTAACGCCCAT -3'

Posted On

2019-12-02