Mutagenetix > Incidental Mutation

Incidental Mutation 'R7427:Nup98'

601430

Institutional Source

Beutler Lab

Gene Symbol

Nup98

Ensembl Gene

ENSMUSG00000063550

Gene Name

nucleoporin 98

Synonyms

Nup96

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7427 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

102119398-102210176 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 102135001 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000147486 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070165] [ENSMUST00000070165] [ENSMUST00000210682] [ENSMUST00000210682] [ENSMUST00000211235] [ENSMUST00000211235]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000070165

SMART Domains

Protein: ENSMUSP00000068530
Gene: ENSMUSG00000063550

Domain	Start	End	E-Value	Type
Pfam:Nucleoporin_FG	3	88	4.6e-4	PFAM
Pfam:Nucleoporin_FG	69	170	3.4e-6	PFAM
Pfam:Nucleoporin_FG	210	307	6.1e-5	PFAM
Pfam:Nucleoporin_FG	246	332	2.2e-7	PFAM
Pfam:Nucleoporin_FG	266	359	1.2e-7	PFAM
Pfam:Nucleoporin_FG	309	425	1.8e-2	PFAM
Pfam:Nucleoporin_FG	398	497	2.2e-2	PFAM
low complexity region	594	610	N/A	INTRINSIC
low complexity region	673	684	N/A	INTRINSIC
Pfam:Nucleoporin2	740	880	5.4e-45	PFAM
PDB:1KO6\|D	881	925	1e-16	PDB
low complexity region	926	935	N/A	INTRINSIC
low complexity region	1033	1042	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000070165

SMART Domains

Protein: ENSMUSP00000068530
Gene: ENSMUSG00000063550

Domain	Start	End	E-Value	Type
Pfam:Nucleoporin_FG	3	88	4.6e-4	PFAM
Pfam:Nucleoporin_FG	69	170	3.4e-6	PFAM
Pfam:Nucleoporin_FG	210	307	6.1e-5	PFAM
Pfam:Nucleoporin_FG	246	332	2.2e-7	PFAM
Pfam:Nucleoporin_FG	266	359	1.2e-7	PFAM
Pfam:Nucleoporin_FG	309	425	1.8e-2	PFAM
Pfam:Nucleoporin_FG	398	497	2.2e-2	PFAM
low complexity region	594	610	N/A	INTRINSIC
low complexity region	673	684	N/A	INTRINSIC
Pfam:Nucleoporin2	740	880	5.4e-45	PFAM
PDB:1KO6\|D	881	925	1e-16	PDB
low complexity region	926	935	N/A	INTRINSIC
low complexity region	1033	1042	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000210682

Predicted Effect

probably null
Transcript: ENSMUST00000210682

Predicted Effect

probably null
Transcript: ENSMUST00000211235

Predicted Effect

probably null
Transcript: ENSMUST00000211235

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (78/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear pore complexes (NPCs) regulate the transport of macromolecules between the nucleus and cytoplasm, and are composed of many polypeptide subunits, many of which belong to the nucleoporin family. This gene belongs to the nucleoporin gene family and encodes a 186 kDa precursor protein that undergoes autoproteolytic cleavage to generate a 98 kDa nucleoporin and 96 kDa nucleoporin. The 98 kDa nucleoporin contains a Gly-Leu-Phe-Gly (GLGF) repeat domain and participates in many cellular processes, including nuclear import, nuclear export, mitotic progression, and regulation of gene expression. The 96 kDa nucleoporin is a scaffold component of the NPC. Proteolytic cleavage is important for targeting of the proteins to the NPC. Translocations between this gene and many other partner genes have been observed in different leukemias. Rearrangements typically result in chimeras with the N-terminal GLGF domain of this gene to the C-terminus of the partner gene. Alternative splicing results in multiple transcript variants encoding different isoforms, at least two of which are proteolytically processed. Some variants lack the region that encodes the 96 kDa nucleoporin. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygotes for a null allele die in utero with a severe growth delay and improper gastrulation and nuclear pore complex assembly/function. Heterozygotes for another null allele show impaired IFN-mediated responses, reduced T and B cell subsets in lymphoid organs and altered T and B cell functions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931423N10Rik	C	T	2: 23,256,994	R337C	probably benign	Het
Adck5	T	A	15: 76,594,385	C318S	possibly damaging	Het
Aspm	T	A	1: 139,457,616	C333S	probably benign	Het
B3gnt4	A	G	5: 123,510,731	N53S	probably damaging	Het
Bpifb5	G	A	2: 154,225,122	M98I	probably benign	Het
Cacna2d3	A	G	14: 29,064,275	M585T	probably damaging	Het
Cbarp	T	C	10: 80,131,304	D701G	probably damaging	Het
Cntrl	T	A	2: 35,170,534	W1913R	probably benign	Het
Cry2	T	C	2: 92,413,047	D483G	possibly damaging	Het
Csmd1	A	G	8: 16,023,850	F2044L	possibly damaging	Het
Ctgf	T	G	10: 24,597,499	M312R	probably damaging	Het
Cxcl16	A	G	11: 70,458,804	V78A	possibly damaging	Het
Cxcr6	A	T	9: 123,810,240	Y109F	probably benign	Het
Cyb5b	A	G	8: 107,170,416	D106G	probably benign	Het
D630036H23Rik	T	C	12: 36,381,538	R154G	unknown	Het
Dnah9	T	C	11: 65,955,219	T2998A	probably benign	Het
Focad	T	C	4: 88,368,751	S1254P	unknown	Het
Gm21886	A	T	18: 80,089,652	L97Q	probably damaging	Het
Gm6614	T	G	6: 142,003,508		probably null	Het
Gpr158	A	C	2: 21,827,318	L1076F	probably benign	Het
Hivep2	T	C	10: 14,133,741	M1714T	possibly damaging	Het
Hlcs	A	G	16: 94,267,899	V154A	probably benign	Het
Hpdl	A	T	4: 116,820,865	L133Q	probably damaging	Het
Il1rn	C	A	2: 24,349,542	T150K	probably benign	Het
Il6st	A	G	13: 112,488,560	I237V	probably benign	Het
Inpp5f	A	G	7: 128,679,805	D510G	probably damaging	Het
Ism2	G	T	12: 87,286,995	T92K	possibly damaging	Het
Kif13b	T	C	14: 64,788,460	I1422T	probably benign	Het
Kit	G	A	5: 75,645,847	V671I	possibly damaging	Het
Klhdc8a	A	T	1: 132,302,967	N190I	probably damaging	Het
Lad1	C	T	1: 135,825,838	T41I	probably damaging	Het
Lrrc7	G	T	3: 158,198,141	T294K	probably benign	Het
Megf8	C	T	7: 25,338,371	R771C	probably benign	Het
Micu3	A	C	8: 40,378,914	N440T	possibly damaging	Het
Mnx1	T	C	5: 29,474,213	N291D	unknown	Het
Mthfr	A	G	4: 148,051,603	M378V	probably benign	Het
Mup2	A	T	4: 60,138,454	D79E	probably benign	Het
Myzap	T	C	9: 71,505,183	T451A	probably benign	Het
Nlrp9c	T	C	7: 26,371,435	D907G	probably benign	Het
Nr1h4	T	C	10: 89,498,405	E41G	probably benign	Het
Nxpe5	A	C	5: 138,239,760	Y194S	probably damaging	Het
Olfr1024	T	A	2: 85,904,131	R308*	probably null	Het
Olfr1032	A	T	2: 86,008,219	I148L	probably benign	Het
Olfr105-ps	T	C	17: 37,383,299	V244A	probably damaging	Het
Olfr1121	G	T	2: 87,371,690	V53L	probably benign	Het
Olfr332	A	G	11: 58,489,780	I325T	probably benign	Het
Olfr466	A	G	13: 65,153,052	Y276C	probably damaging	Het
Olfr554	A	G	7: 102,640,326	I27V	probably benign	Het
Omd	A	T	13: 49,592,269	E385V	possibly damaging	Het
Pcdh9	G	T	14: 93,887,111	T541K	probably damaging	Het
Pdia6	T	C	12: 17,278,545	V167A	probably damaging	Het
Phf7	C	T	14: 31,240,413	R145Q	possibly damaging	Het
Pitx3	T	C	19: 46,137,424	D20G	possibly damaging	Het
Plxnb1	T	C	9: 109,108,168	V1139A	probably benign	Het
Pon2	A	T	6: 5,268,995	N226K	probably damaging	Het
Ppp1r10	T	A	17: 35,930,133	H642Q	possibly damaging	Het
Prom2	A	G	2: 127,539,811	L195P	probably damaging	Het
Psg23	C	T	7: 18,611,983		probably null	Het
Rfx4	C	A	10: 84,896,012	Q618K	probably benign	Het
Rhobtb1	T	A	10: 69,248,824	I15N	probably damaging	Het
Rhot2	A	T	17: 25,841,609	V233E	probably damaging	Het
Ripply2	T	C	9: 87,019,756	S112P	possibly damaging	Het
Slc12a1	C	A	2: 125,214,132	T861N	probably benign	Het
Slc35f1	T	A	10: 53,089,414	S308R	probably damaging	Het
Slc35f4	T	A	14: 49,298,898	I427F	probably damaging	Het
Sned1	G	A	1: 93,289,358	V1322I	probably benign	Het
Sprr2f	G	A	3: 92,365,944	V17M	unknown	Het
Srd5a3	A	G	5: 76,154,643	H285R	probably benign	Het
Stab1	T	C	14: 31,159,259	T605A	probably benign	Het
Syne1	T	C	10: 5,273,718	Q3054R	probably damaging	Het
Tas1r1	T	C	4: 152,038,308	T27A	probably benign	Het
Tmem150b	A	T	7: 4,716,210	V237E	probably benign	Het
Trpv6	C	T	6: 41,625,153	M407I	probably benign	Het
Ttn	T	G	2: 76,720,354	D31528A	probably damaging	Het
Uroc1	A	T	6: 90,346,362	D354V	possibly damaging	Het
Vmn2r69	T	C	7: 85,411,259	I372M	probably benign	Het
Vmn2r93	A	T	17: 18,326,410	H848L	probably benign	Het
Zfp971	T	A	2: 178,033,174	C189S	probably damaging	Het

Other mutations in Nup98

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00662:Nup98	APN	7	102194987	missense	probably damaging	1.00
IGL00789:Nup98	APN	7	102153971	missense	probably benign
IGL00798:Nup98	APN	7	102147204	missense	probably damaging	1.00
IGL01562:Nup98	APN	7	102185918	missense	probably damaging	0.99
IGL01942:Nup98	APN	7	102194711	missense	probably damaging	1.00
IGL02109:Nup98	APN	7	102183486	missense	probably benign	0.37
IGL02490:Nup98	APN	7	102152366	missense	probably damaging	1.00
IGL03184:Nup98	APN	7	102183545	missense	probably damaging	0.99
PIT4519001:Nup98	UTSW	7	102134964	missense	probably benign	0.00
R0040:Nup98	UTSW	7	102192034	missense	probably damaging	1.00
R0133:Nup98	UTSW	7	102139652	critical splice acceptor site	probably null
R0309:Nup98	UTSW	7	102152428	missense	probably null
R0471:Nup98	UTSW	7	102138797	missense	probably benign	0.13
R0538:Nup98	UTSW	7	102186685	missense	probably damaging	1.00
R0650:Nup98	UTSW	7	102152453	missense	probably damaging	1.00
R0730:Nup98	UTSW	7	102160716	missense	probably damaging	1.00
R0881:Nup98	UTSW	7	102160716	missense	probably damaging	1.00
R0900:Nup98	UTSW	7	102160716	missense	probably damaging	1.00
R1120:Nup98	UTSW	7	102160716	missense	probably damaging	1.00
R1159:Nup98	UTSW	7	102160716	missense	probably damaging	1.00
R1469:Nup98	UTSW	7	102138801	missense	probably benign	0.00
R1469:Nup98	UTSW	7	102138801	missense	probably benign	0.00
R1470:Nup98	UTSW	7	102147306	missense	probably damaging	0.98
R1470:Nup98	UTSW	7	102147306	missense	probably damaging	0.98
R1545:Nup98	UTSW	7	102134880	missense	possibly damaging	0.77
R1775:Nup98	UTSW	7	102134937	missense	probably benign	0.03
R1889:Nup98	UTSW	7	102160716	missense	probably damaging	1.00
R2080:Nup98	UTSW	7	102180424	missense	probably damaging	0.96
R3423:Nup98	UTSW	7	102184877	missense	probably benign	0.03
R4361:Nup98	UTSW	7	102145714	missense	probably damaging	1.00
R4678:Nup98	UTSW	7	102184831	missense	probably damaging	1.00
R4864:Nup98	UTSW	7	102153196	missense	possibly damaging	0.94
R4910:Nup98	UTSW	7	102195800	missense	unknown
R4924:Nup98	UTSW	7	102134978	missense	probably damaging	1.00
R5068:Nup98	UTSW	7	102145655	missense	probably benign	0.00
R5069:Nup98	UTSW	7	102145655	missense	probably benign	0.00
R5233:Nup98	UTSW	7	102195822	missense	unknown
R5779:Nup98	UTSW	7	102152361	missense	probably benign
R5922:Nup98	UTSW	7	102154017	missense	probably damaging	1.00
R6010:Nup98	UTSW	7	102180429	missense	probably damaging	1.00
R6039:Nup98	UTSW	7	102134795	missense	probably benign
R6039:Nup98	UTSW	7	102134795	missense	probably benign
R6343:Nup98	UTSW	7	102194750	missense	possibly damaging	0.90
R6364:Nup98	UTSW	7	102176315	missense	probably damaging	1.00
R6462:Nup98	UTSW	7	102195016	missense	probably benign	0.03
R6577:Nup98	UTSW	7	102128846	splice site	probably null
R6900:Nup98	UTSW	7	102185962	missense	probably damaging	1.00
R7205:Nup98	UTSW	7	102195041	missense	unknown
R7218:Nup98	UTSW	7	102191900	splice site	probably null
R7235:Nup98	UTSW	7	102125284	missense	probably damaging	1.00
R7307:Nup98	UTSW	7	102134795	missense	probably benign
R7402:Nup98	UTSW	7	102134937	missense	probably benign	0.00
R7428:Nup98	UTSW	7	102135001	splice site	probably null
R7584:Nup98	UTSW	7	102176389	missense	probably benign	0.02
R7646:Nup98	UTSW	7	102154035	missense	probably benign	0.01
R7648:Nup98	UTSW	7	102124197	missense	possibly damaging	0.94
R7742:Nup98	UTSW	7	102153257	splice site	probably null
R7827:Nup98	UTSW	7	102124362	missense	probably benign	0.10
R7884:Nup98	UTSW	7	102176349	missense	probably benign	0.12
R7943:Nup98	UTSW	7	102194822	missense	probably benign	0.10
R8034:Nup98	UTSW	7	102145723	critical splice acceptor site	probably null
R8952:Nup98	UTSW	7	102186652	missense	probably damaging	1.00
R9060:Nup98	UTSW	7	102134688	missense	probably damaging	1.00
R9099:Nup98	UTSW	7	102194966	missense	probably damaging	0.98
R9146:Nup98	UTSW	7	102138830	missense	probably benign	0.02
R9148:Nup98	UTSW	7	102138830	missense	probably benign	0.02
R9223:Nup98	UTSW	7	102184960	missense	possibly damaging	0.82
R9246:Nup98	UTSW	7	102138830	missense	probably benign	0.02
R9249:Nup98	UTSW	7	102138830	missense	probably benign	0.02
R9272:Nup98	UTSW	7	102138830	missense	probably benign	0.02
R9274:Nup98	UTSW	7	102138830	missense	probably benign	0.02
R9283:Nup98	UTSW	7	102138830	missense	probably benign	0.02
R9326:Nup98	UTSW	7	102138830	missense	probably benign	0.02
R9466:Nup98	UTSW	7	102169404	missense	probably benign	0.05
R9492:Nup98	UTSW	7	102129045	missense	probably benign	0.11
R9661:Nup98	UTSW	7	102132812	nonsense	probably null
T0970:Nup98	UTSW	7	102186752	unclassified	probably benign
X0054:Nup98	UTSW	7	102147208	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCTGGGCACTGTGAACA -3'
(R):5'- CTCTTGCTTTGATTTCACATCTGAA -3'

Sequencing Primer
(F):5'- TGTGAACACAGTGGCCAG -3'
(R):5'- TTCAGGAGCATTGGACACCTG -3'

Posted On

2019-12-02