Incidental Mutation 'R7815:Man1a2'
ID601451
Institutional Source Beutler Lab
Gene Symbol Man1a2
Ensembl Gene ENSMUSG00000008763
Gene Namemannosidase, alpha, class 1A, member 2
SynonymsMan1b
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7815 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location100562208-100685503 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100656179 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 50 (I50N)
Ref Sequence ENSEMBL: ENSMUSP00000116489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008907] [ENSMUST00000130066] [ENSMUST00000196250]
Predicted Effect probably damaging
Transcript: ENSMUST00000008907
AA Change: I133N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000008907
Gene: ENSMUSG00000008763
AA Change: I133N

DomainStartEndE-ValueType
transmembrane domain 37 56 N/A INTRINSIC
coiled coil region 101 153 N/A INTRINSIC
low complexity region 155 170 N/A INTRINSIC
Pfam:Glyco_hydro_47 187 626 2.8e-156 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130066
AA Change: I50N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116489
Gene: ENSMUSG00000008763
AA Change: I50N

DomainStartEndE-ValueType
coiled coil region 18 70 N/A INTRINSIC
low complexity region 72 87 N/A INTRINSIC
Pfam:Glyco_hydro_47 104 179 1.2e-23 PFAM
Pfam:Glyco_hydro_47 174 246 1.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196250
SMART Domains Protein: ENSMUSP00000143695
Gene: ENSMUSG00000008763

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha-mannosidases function at different stages of N-glycan maturation in mammalian cells. See MAN2A1 (MIM 154582) for general information.[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutation of this gene results in respiratory distress and death within a few hours after birth. Lung development is delayed, the alveolar septum is thickened, and hemorrhage occurs in the alveolar region. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A G 19: 43,830,427 D1285G probably benign Het
Abcc9 A G 6: 142,652,605 V669A probably damaging Het
Ajap1 C A 4: 153,432,831 G18C probably damaging Het
Alms1 G T 6: 85,615,358 M397I probably benign Het
Ampd2 A T 3: 108,074,931 M794K probably benign Het
Ankrd35 A T 3: 96,684,801 Q801L probably damaging Het
Casz1 A T 4: 148,929,305 I109F possibly damaging Het
Ces5a G A 8: 93,520,995 S297F possibly damaging Het
Col7a1 A G 9: 108,969,565 D1762G probably damaging Het
Dsp A T 13: 38,191,470 Y1077F probably benign Het
Eef2k A G 7: 120,858,570 N51D probably benign Het
Erbb4 A G 1: 68,042,726 Y1050H probably damaging Het
Fpgt A T 3: 155,086,652 S579R probably benign Het
Gabra4 T A 5: 71,657,809 M1L possibly damaging Het
Galk2 G A 2: 125,975,401 S370N probably damaging Het
Gpr155 T A 2: 73,362,560 T516S probably benign Het
Homez T C 14: 54,858,218 N11S probably benign Het
Hspg2 G A 4: 137,512,464 G494D probably damaging Het
Htr3b C T 9: 48,945,533 R215Q probably benign Het
Igfbp4 A G 11: 99,041,828 E111G probably benign Het
Igkv8-19 T C 6: 70,341,436 T5A probably benign Het
Insrr A G 3: 87,808,695 K566E probably damaging Het
Iqsec3 A G 6: 121,473,358 V69A probably benign Het
Kdm5d T C Y: 940,702 V1071A probably damaging Het
Kif28 A G 1: 179,735,983 C143R probably damaging Het
Kpna6 T C 4: 129,657,797 M65V probably benign Het
L3mbtl3 T C 10: 26,280,378 S669G unknown Het
Map3k11 A T 19: 5,695,639 M356L possibly damaging Het
Meioc A T 11: 102,675,588 N677Y probably damaging Het
Myom3 A T 4: 135,801,363 K1108M possibly damaging Het
Nav1 C T 1: 135,584,639 E228K possibly damaging Het
Ncapd3 G A 9: 27,063,440 W736* probably null Het
Nfkb1 T C 3: 135,603,791 D514G probably damaging Het
Nnt T A 13: 119,357,575 T657S possibly damaging Het
Olfr66 A G 7: 103,881,785 S153P probably benign Het
Olfr729 A G 14: 50,148,796 F26S probably benign Het
Oser1 A T 2: 163,411,416 S58T possibly damaging Het
Pcdha5 T A 18: 36,961,503 I355N possibly damaging Het
Pllp C G 8: 94,676,176 G99A probably damaging Het
Pram1 A G 17: 33,642,132 N509S probably benign Het
Prkd1 A C 12: 50,425,517 N204K probably damaging Het
Prss23 G A 7: 89,510,045 P272L probably damaging Het
Pxdn T C 12: 30,005,825 F1057L probably damaging Het
Rapgef5 T A 12: 117,755,967 S777R probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rfx3 A T 19: 27,826,048 M265K probably benign Het
S100a7a C A 3: 90,657,812 H105N probably benign Het
Serpinb3b T C 1: 107,156,895 D132G probably damaging Het
Sp7 T A 15: 102,366,387 probably benign Het
Tacstd2 A G 6: 67,535,156 F184S possibly damaging Het
Trdc C A 14: 54,143,802 probably benign Het
Trpa1 T A 1: 14,904,262 H232L probably benign Het
Trpc3 G T 3: 36,655,145 T394K probably benign Het
Tuba3b G A 6: 145,621,121 V363I possibly damaging Het
Tubb2a C A 13: 34,074,979 R276L probably benign Het
Ubap2l A T 3: 90,043,764 L72* probably null Het
Vps13a A T 19: 16,725,572 D672E probably damaging Het
Wdr26 A G 1: 181,209,073 V166A probably benign Het
Wwox T C 8: 114,712,036 S281P probably damaging Het
Xirp2 G A 2: 67,509,412 G666R probably damaging Het
Zfp131 T C 13: 119,775,980 K247E probably damaging Het
Other mutations in Man1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:Man1a2 APN 3 100644557 missense probably damaging 1.00
IGL02009:Man1a2 APN 3 100684662 missense probably damaging 0.99
IGL02097:Man1a2 APN 3 100582131 missense possibly damaging 0.68
IGL02395:Man1a2 APN 3 100644537 splice site probably null
IGL02441:Man1a2 APN 3 100591873 missense probably benign 0.01
R0043:Man1a2 UTSW 3 100587880 missense probably damaging 1.00
R0064:Man1a2 UTSW 3 100591883 missense possibly damaging 0.95
R0217:Man1a2 UTSW 3 100617037 missense possibly damaging 0.61
R0266:Man1a2 UTSW 3 100582034 missense probably damaging 1.00
R0284:Man1a2 UTSW 3 100684786 missense probably damaging 0.98
R0633:Man1a2 UTSW 3 100684575 missense possibly damaging 0.80
R1074:Man1a2 UTSW 3 100656086 missense possibly damaging 0.68
R2167:Man1a2 UTSW 3 100591900 missense probably damaging 1.00
R2177:Man1a2 UTSW 3 100632531 missense probably damaging 1.00
R3822:Man1a2 UTSW 3 100632597 missense possibly damaging 0.48
R4361:Man1a2 UTSW 3 100656042 missense probably benign
R4652:Man1a2 UTSW 3 100632561 missense probably damaging 1.00
R4871:Man1a2 UTSW 3 100617056 missense probably damaging 1.00
R5153:Man1a2 UTSW 3 100656263 missense probably damaging 1.00
R5182:Man1a2 UTSW 3 100647017 missense probably damaging 0.99
R5201:Man1a2 UTSW 3 100617012 missense probably benign
R5251:Man1a2 UTSW 3 100620099 missense probably damaging 1.00
R6135:Man1a2 UTSW 3 100684932 start gained probably benign
R6793:Man1a2 UTSW 3 100632597 missense possibly damaging 0.48
R6886:Man1a2 UTSW 3 100656071 missense probably benign 0.00
R7209:Man1a2 UTSW 3 100647079 missense unknown
R7224:Man1a2 UTSW 3 100582053 missense possibly damaging 0.85
R7308:Man1a2 UTSW 3 100620105 missense probably damaging 1.00
R7826:Man1a2 UTSW 3 100582139 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGATCACCAACCTCAGC -3'
(R):5'- CTGTTCTTTGAGCAGATGACTTTC -3'

Sequencing Primer
(F):5'- TGGATCACCAACCTCAGCTTATTAC -3'
(R):5'- CCTTTTAATGTGGGGGACTAGAAAAC -3'
Posted On2019-12-03