Mutagenetix > Incidental Mutations

Incidental Mutation 'R7815:Man1a2'

601451

Institutional Source

Beutler Lab

Gene Symbol

Man1a2

Ensembl Gene

ENSMUSG00000008763

Gene Name

mannosidase, alpha, class 1A, member 2

Synonyms

Man1b

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7815 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

100562208-100685503 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 100656179 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 50 (I50N)

Ref Sequence

ENSEMBL: ENSMUSP00000116489 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008907] [ENSMUST00000130066] [ENSMUST00000196250]

Predicted Effect

probably damaging
Transcript: ENSMUST00000008907
AA Change: I133N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000008907
Gene: ENSMUSG00000008763
AA Change: I133N

Domain	Start	End	E-Value	Type
transmembrane domain	37	56	N/A	INTRINSIC
coiled coil region	101	153	N/A	INTRINSIC
low complexity region	155	170	N/A	INTRINSIC
Pfam:Glyco_hydro_47	187	626	2.8e-156	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000130066
AA Change: I50N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000116489
Gene: ENSMUSG00000008763
AA Change: I50N

Domain	Start	End	E-Value	Type
coiled coil region	18	70	N/A	INTRINSIC
low complexity region	72	87	N/A	INTRINSIC
Pfam:Glyco_hydro_47	104	179	1.2e-23	PFAM
Pfam:Glyco_hydro_47	174	246	1.1e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000196250

SMART Domains

Protein: ENSMUSP00000143695
Gene: ENSMUSG00000008763

Domain	Start	End	E-Value	Type
transmembrane domain	38	57	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha-mannosidases function at different stages of N-glycan maturation in mammalian cells. See MAN2A1 (MIM 154582) for general information.[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutation of this gene results in respiratory distress and death within a few hours after birth. Lung development is delayed, the alveolar septum is thickened, and hemorrhage occurs in the alveolar region. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc2	A	G	19: 43,830,427	D1285G	probably benign	Het
Abcc9	A	G	6: 142,652,605	V669A	probably damaging	Het
Ajap1	C	A	4: 153,432,831	G18C	probably damaging	Het
Alms1	G	T	6: 85,615,358	M397I	probably benign	Het
Ampd2	A	T	3: 108,074,931	M794K	probably benign	Het
Ankrd35	A	T	3: 96,684,801	Q801L	probably damaging	Het
Casz1	A	T	4: 148,929,305	I109F	possibly damaging	Het
Ces5a	G	A	8: 93,520,995	S297F	possibly damaging	Het
Col7a1	A	G	9: 108,969,565	D1762G	probably damaging	Het
Dsp	A	T	13: 38,191,470	Y1077F	probably benign	Het
Eef2k	A	G	7: 120,858,570	N51D	probably benign	Het
Erbb4	A	G	1: 68,042,726	Y1050H	probably damaging	Het
Fpgt	A	T	3: 155,086,652	S579R	probably benign	Het
Gabra4	T	A	5: 71,657,809	M1L	possibly damaging	Het
Galk2	G	A	2: 125,975,401	S370N	probably damaging	Het
Gpr155	T	A	2: 73,362,560	T516S	probably benign	Het
Homez	T	C	14: 54,858,218	N11S	probably benign	Het
Hspg2	G	A	4: 137,512,464	G494D	probably damaging	Het
Htr3b	C	T	9: 48,945,533	R215Q	probably benign	Het
Igfbp4	A	G	11: 99,041,828	E111G	probably benign	Het
Igkv8-19	T	C	6: 70,341,436	T5A	probably benign	Het
Insrr	A	G	3: 87,808,695	K566E	probably damaging	Het
Iqsec3	A	G	6: 121,473,358	V69A	probably benign	Het
Kdm5d	T	C	Y: 940,702	V1071A	probably damaging	Het
Kif28	A	G	1: 179,735,983	C143R	probably damaging	Het
Kpna6	T	C	4: 129,657,797	M65V	probably benign	Het
L3mbtl3	T	C	10: 26,280,378	S669G	unknown	Het
Map3k11	A	T	19: 5,695,639	M356L	possibly damaging	Het
Meioc	A	T	11: 102,675,588	N677Y	probably damaging	Het
Myom3	A	T	4: 135,801,363	K1108M	possibly damaging	Het
Nav1	C	T	1: 135,584,639	E228K	possibly damaging	Het
Ncapd3	G	A	9: 27,063,440	W736*	probably null	Het
Nfkb1	T	C	3: 135,603,791	D514G	probably damaging	Het
Nnt	T	A	13: 119,357,575	T657S	possibly damaging	Het
Olfr66	A	G	7: 103,881,785	S153P	probably benign	Het
Olfr729	A	G	14: 50,148,796	F26S	probably benign	Het
Oser1	A	T	2: 163,411,416	S58T	possibly damaging	Het
Pcdha5	T	A	18: 36,961,503	I355N	possibly damaging	Het
Pllp	C	G	8: 94,676,176	G99A	probably damaging	Het
Pram1	A	G	17: 33,642,132	N509S	probably benign	Het
Prkd1	A	C	12: 50,425,517	N204K	probably damaging	Het
Prss23	G	A	7: 89,510,045	P272L	probably damaging	Het
Pxdn	T	C	12: 30,005,825	F1057L	probably damaging	Het
Rapgef5	T	A	12: 117,755,967	S777R	probably benign	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rfx3	A	T	19: 27,826,048	M265K	probably benign	Het
S100a7a	C	A	3: 90,657,812	H105N	probably benign	Het
Serpinb3b	T	C	1: 107,156,895	D132G	probably damaging	Het
Sp7	T	A	15: 102,366,387		probably benign	Het
Tacstd2	A	G	6: 67,535,156	F184S	possibly damaging	Het
Trdc	C	A	14: 54,143,802		probably benign	Het
Trpa1	T	A	1: 14,904,262	H232L	probably benign	Het
Trpc3	G	T	3: 36,655,145	T394K	probably benign	Het
Tuba3b	G	A	6: 145,621,121	V363I	possibly damaging	Het
Tubb2a	C	A	13: 34,074,979	R276L	probably benign	Het
Ubap2l	A	T	3: 90,043,764	L72*	probably null	Het
Vps13a	A	T	19: 16,725,572	D672E	probably damaging	Het
Wdr26	A	G	1: 181,209,073	V166A	probably benign	Het
Wwox	T	C	8: 114,712,036	S281P	probably damaging	Het
Xirp2	G	A	2: 67,509,412	G666R	probably damaging	Het
Zfp131	T	C	13: 119,775,980	K247E	probably damaging	Het

Other mutations in Man1a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01987:Man1a2	APN	3	100644557	missense	probably damaging	1.00
IGL02009:Man1a2	APN	3	100684662	missense	probably damaging	0.99
IGL02097:Man1a2	APN	3	100582131	missense	possibly damaging	0.68
IGL02395:Man1a2	APN	3	100644537	splice site	probably null
IGL02441:Man1a2	APN	3	100591873	missense	probably benign	0.01
R0043:Man1a2	UTSW	3	100587880	missense	probably damaging	1.00
R0064:Man1a2	UTSW	3	100591883	missense	possibly damaging	0.95
R0217:Man1a2	UTSW	3	100617037	missense	possibly damaging	0.61
R0266:Man1a2	UTSW	3	100582034	missense	probably damaging	1.00
R0284:Man1a2	UTSW	3	100684786	missense	probably damaging	0.98
R0633:Man1a2	UTSW	3	100684575	missense	possibly damaging	0.80
R1074:Man1a2	UTSW	3	100656086	missense	possibly damaging	0.68
R2167:Man1a2	UTSW	3	100591900	missense	probably damaging	1.00
R2177:Man1a2	UTSW	3	100632531	missense	probably damaging	1.00
R3822:Man1a2	UTSW	3	100632597	missense	possibly damaging	0.48
R4361:Man1a2	UTSW	3	100656042	missense	probably benign
R4652:Man1a2	UTSW	3	100632561	missense	probably damaging	1.00
R4871:Man1a2	UTSW	3	100617056	missense	probably damaging	1.00
R5153:Man1a2	UTSW	3	100656263	missense	probably damaging	1.00
R5182:Man1a2	UTSW	3	100647017	missense	probably damaging	0.99
R5201:Man1a2	UTSW	3	100617012	missense	probably benign
R5251:Man1a2	UTSW	3	100620099	missense	probably damaging	1.00
R6135:Man1a2	UTSW	3	100684932	start gained	probably benign
R6793:Man1a2	UTSW	3	100632597	missense	possibly damaging	0.48
R6886:Man1a2	UTSW	3	100656071	missense	probably benign	0.00
R7209:Man1a2	UTSW	3	100647079	missense	unknown
R7224:Man1a2	UTSW	3	100582053	missense	possibly damaging	0.85
R7308:Man1a2	UTSW	3	100620105	missense	probably damaging	1.00
R7826:Man1a2	UTSW	3	100582139	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTGGATCACCAACCTCAGC -3'
(R):5'- CTGTTCTTTGAGCAGATGACTTTC -3'

Sequencing Primer
(F):5'- TGGATCACCAACCTCAGCTTATTAC -3'
(R):5'- CCTTTTAATGTGGGGGACTAGAAAAC -3'

Posted On

2019-12-03