Incidental Mutation 'R7815:Meioc'
ID 601479
Institutional Source Beutler Lab
Gene Symbol Meioc
Ensembl Gene ENSMUSG00000051455
Gene Name meiosis specific with coiled-coil domain
Synonyms Gm1564, LOC380729, LOC268491
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock # R7815 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 102663716-102682237 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 102675588 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 677 (N677Y)
Ref Sequence ENSEMBL: ENSMUSP00000097947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100378] [ENSMUST00000156590]
AlphaFold A2AG06
Predicted Effect probably damaging
Transcript: ENSMUST00000100378
AA Change: N677Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097947
Gene: ENSMUSG00000051455
AA Change: N677Y

DomainStartEndE-ValueType
low complexity region 526 537 N/A INTRINSIC
low complexity region 712 728 N/A INTRINSIC
Pfam:DUF4582 757 922 5.1e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156590
SMART Domains Protein: ENSMUSP00000116246
Gene: ENSMUSG00000051455

DomainStartEndE-ValueType
low complexity region 470 481 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit infertility with small gonads, absent germ cells and arrested meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A G 19: 43,830,427 D1285G probably benign Het
Abcc9 A G 6: 142,652,605 V669A probably damaging Het
Ajap1 C A 4: 153,432,831 G18C probably damaging Het
Alms1 G T 6: 85,615,358 M397I probably benign Het
Ampd2 A T 3: 108,074,931 M794K probably benign Het
Ankrd35 A T 3: 96,684,801 Q801L probably damaging Het
Casz1 A T 4: 148,929,305 I109F possibly damaging Het
Ces5a G A 8: 93,520,995 S297F possibly damaging Het
Col7a1 A G 9: 108,969,565 D1762G probably damaging Het
Dsp A T 13: 38,191,470 Y1077F probably benign Het
Eef2k A G 7: 120,858,570 N51D probably benign Het
Erbb4 A G 1: 68,042,726 Y1050H probably damaging Het
Fpgt A T 3: 155,086,652 S579R probably benign Het
Gabra4 T A 5: 71,657,809 M1L possibly damaging Het
Galk2 G A 2: 125,975,401 S370N probably damaging Het
Gpr155 T A 2: 73,362,560 T516S probably benign Het
Homez T C 14: 54,858,218 N11S probably benign Het
Hspg2 G A 4: 137,512,464 G494D probably damaging Het
Htr3b C T 9: 48,945,533 R215Q probably benign Het
Igfbp4 A G 11: 99,041,828 E111G probably benign Het
Igkv8-19 T C 6: 70,341,436 T5A probably benign Het
Insrr A G 3: 87,808,695 K566E probably damaging Het
Iqsec3 A G 6: 121,473,358 V69A probably benign Het
Kdm5d T C Y: 940,702 V1071A probably damaging Het
Kif28 A G 1: 179,735,983 C143R probably damaging Het
Kpna6 T C 4: 129,657,797 M65V probably benign Het
L3mbtl3 T C 10: 26,280,378 S669G unknown Het
Man1a2 A T 3: 100,656,179 I50N probably damaging Het
Map3k11 A T 19: 5,695,639 M356L possibly damaging Het
Myom3 A T 4: 135,801,363 K1108M possibly damaging Het
Nav1 C T 1: 135,584,639 E228K possibly damaging Het
Ncapd3 G A 9: 27,063,440 W736* probably null Het
Nfkb1 T C 3: 135,603,791 D514G probably damaging Het
Nnt T A 13: 119,357,575 T657S possibly damaging Het
Olfr66 A G 7: 103,881,785 S153P probably benign Het
Olfr729 A G 14: 50,148,796 F26S probably benign Het
Oser1 A T 2: 163,411,416 S58T possibly damaging Het
Pcdha5 T A 18: 36,961,503 I355N possibly damaging Het
Pllp C G 8: 94,676,176 G99A probably damaging Het
Pram1 A G 17: 33,642,132 N509S probably benign Het
Prkd1 A C 12: 50,425,517 N204K probably damaging Het
Prss23 G A 7: 89,510,045 P272L probably damaging Het
Pxdn T C 12: 30,005,825 F1057L probably damaging Het
Rapgef5 T A 12: 117,755,967 S777R probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rfx3 A T 19: 27,826,048 M265K probably benign Het
S100a7a C A 3: 90,657,812 H105N probably benign Het
Serpinb3b T C 1: 107,156,895 D132G probably damaging Het
Sp7 T A 15: 102,366,387 probably benign Het
Tacstd2 A G 6: 67,535,156 F184S possibly damaging Het
Trdc C A 14: 54,143,802 probably benign Het
Trpa1 T A 1: 14,904,262 H232L probably benign Het
Trpc3 G T 3: 36,655,145 T394K probably benign Het
Tuba3b G A 6: 145,621,121 V363I possibly damaging Het
Tubb2a C A 13: 34,074,979 R276L probably benign Het
Ubap2l A T 3: 90,043,764 L72* probably null Het
Vps13a A T 19: 16,725,572 D672E probably damaging Het
Wdr26 A G 1: 181,209,073 V166A probably benign Het
Wwox T C 8: 114,712,036 S281P probably damaging Het
Xirp2 G A 2: 67,509,412 G666R probably damaging Het
Zfp131 T C 13: 119,775,980 K247E probably damaging Het
Other mutations in Meioc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Meioc APN 11 102674287 missense probably benign 0.33
IGL01952:Meioc APN 11 102672185 missense possibly damaging 0.79
IGL02006:Meioc APN 11 102674266 missense probably damaging 1.00
IGL02195:Meioc APN 11 102674857 missense possibly damaging 0.91
IGL02339:Meioc APN 11 102668448 missense probably benign 0.18
IGL02935:Meioc APN 11 102672191 missense probably benign 0.06
IGL03294:Meioc APN 11 102680669 missense probably damaging 1.00
PIT4519001:Meioc UTSW 11 102679957 missense probably damaging 1.00
R0285:Meioc UTSW 11 102672191 missense probably benign 0.06
R0964:Meioc UTSW 11 102680031 missense probably damaging 1.00
R1074:Meioc UTSW 11 102675393 missense probably damaging 1.00
R2024:Meioc UTSW 11 102675358 missense probably benign 0.00
R4012:Meioc UTSW 11 102675828 missense probably damaging 0.99
R4429:Meioc UTSW 11 102675720 missense probably damaging 1.00
R4491:Meioc UTSW 11 102674920 missense possibly damaging 0.84
R4594:Meioc UTSW 11 102674166 missense probably damaging 1.00
R4752:Meioc UTSW 11 102674433 missense probably benign 0.00
R5301:Meioc UTSW 11 102680045 missense probably damaging 1.00
R5352:Meioc UTSW 11 102675313 missense probably benign 0.03
R5646:Meioc UTSW 11 102675257 missense possibly damaging 0.94
R5958:Meioc UTSW 11 102675153 missense probably benign 0.41
R5968:Meioc UTSW 11 102675831 missense probably damaging 0.99
R6157:Meioc UTSW 11 102668401 missense probably damaging 1.00
R6410:Meioc UTSW 11 102675034 missense probably benign 0.00
R6644:Meioc UTSW 11 102668460 critical splice donor site probably null
R7285:Meioc UTSW 11 102666342 missense probably benign 0.00
R7440:Meioc UTSW 11 102674237 missense possibly damaging 0.67
R7984:Meioc UTSW 11 102674606 missense possibly damaging 0.94
R8009:Meioc UTSW 11 102676743 missense probably damaging 1.00
R8078:Meioc UTSW 11 102668400 nonsense probably null
R8195:Meioc UTSW 11 102675067 nonsense probably null
R8429:Meioc UTSW 11 102674206 missense probably benign 0.06
R8797:Meioc UTSW 11 102676860 nonsense probably null
R8854:Meioc UTSW 11 102675763 missense probably damaging 0.98
R8891:Meioc UTSW 11 102668420 missense probably benign 0.43
R9081:Meioc UTSW 11 102674175 missense probably benign 0.00
R9360:Meioc UTSW 11 102674953 missense probably benign 0.13
Z1177:Meioc UTSW 11 102666364 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTGGACATTATGATCCTGAGGAC -3'
(R):5'- GTCCACTACGGGTTTTAATTGG -3'

Sequencing Primer
(F):5'- GGACATTATGATCCTGAGGACATTCC -3'
(R):5'- CGGGTTTTAATTGGTCTTTGAAATCC -3'
Posted On 2019-12-03