Incidental Mutation 'R7815:Map3k11'
ID601493
Institutional Source Beutler Lab
Gene Symbol Map3k11
Ensembl Gene ENSMUSG00000004054
Gene Namemitogen-activated protein kinase kinase kinase 11
SynonymsMlk3, 2610017K16Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.475) question?
Stock #R7815 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location5689131-5702862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5695639 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 356 (M356L)
Ref Sequence ENSEMBL: ENSMUSP00000004156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004156]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004156
AA Change: M356L

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000004156
Gene: ENSMUSG00000004054
AA Change: M356L

DomainStartEndE-ValueType
low complexity region 11 36 N/A INTRINSIC
SH3 45 105 6.79e-19 SMART
TyrKc 118 377 6.83e-81 SMART
coiled coil region 398 444 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 593 610 N/A INTRINSIC
low complexity region 614 632 N/A INTRINSIC
low complexity region 676 697 N/A INTRINSIC
low complexity region 759 778 N/A INTRINSIC
low complexity region 786 805 N/A INTRINSIC
low complexity region 809 820 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine kinase family. This kinase contains a SH3 domain and a leucine zipper-basic motif. This kinase preferentially activates MAPK8/JNK kinase, and functions as a positive regulator of JNK signaling pathway. This kinase can directly phosphorylate, and activates IkappaB kinase alpha and beta, and is found to be involved in the transcription activity of NF-kappaB mediated by Rho family GTPases and CDC42. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted or spontaneous mutation display a pattern of dark red stripes of thin dorsal epithelium during pre-wean development, and necrotic dental pulp has been reported for the spontaneous mutant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A G 19: 43,830,427 D1285G probably benign Het
Abcc9 A G 6: 142,652,605 V669A probably damaging Het
Ajap1 C A 4: 153,432,831 G18C probably damaging Het
Alms1 G T 6: 85,615,358 M397I probably benign Het
Ampd2 A T 3: 108,074,931 M794K probably benign Het
Ankrd35 A T 3: 96,684,801 Q801L probably damaging Het
Casz1 A T 4: 148,929,305 I109F possibly damaging Het
Ces5a G A 8: 93,520,995 S297F possibly damaging Het
Col7a1 A G 9: 108,969,565 D1762G probably damaging Het
Dsp A T 13: 38,191,470 Y1077F probably benign Het
Eef2k A G 7: 120,858,570 N51D probably benign Het
Erbb4 A G 1: 68,042,726 Y1050H probably damaging Het
Fpgt A T 3: 155,086,652 S579R probably benign Het
Gabra4 T A 5: 71,657,809 M1L possibly damaging Het
Galk2 G A 2: 125,975,401 S370N probably damaging Het
Gpr155 T A 2: 73,362,560 T516S probably benign Het
Homez T C 14: 54,858,218 N11S probably benign Het
Hspg2 G A 4: 137,512,464 G494D probably damaging Het
Htr3b C T 9: 48,945,533 R215Q probably benign Het
Igfbp4 A G 11: 99,041,828 E111G probably benign Het
Igkv8-19 T C 6: 70,341,436 T5A probably benign Het
Insrr A G 3: 87,808,695 K566E probably damaging Het
Iqsec3 A G 6: 121,473,358 V69A probably benign Het
Kdm5d T C Y: 940,702 V1071A probably damaging Het
Kif28 A G 1: 179,735,983 C143R probably damaging Het
Kpna6 T C 4: 129,657,797 M65V probably benign Het
L3mbtl3 T C 10: 26,280,378 S669G unknown Het
Man1a2 A T 3: 100,656,179 I50N probably damaging Het
Meioc A T 11: 102,675,588 N677Y probably damaging Het
Myom3 A T 4: 135,801,363 K1108M possibly damaging Het
Nav1 C T 1: 135,584,639 E228K possibly damaging Het
Ncapd3 G A 9: 27,063,440 W736* probably null Het
Nfkb1 T C 3: 135,603,791 D514G probably damaging Het
Nnt T A 13: 119,357,575 T657S possibly damaging Het
Olfr66 A G 7: 103,881,785 S153P probably benign Het
Olfr729 A G 14: 50,148,796 F26S probably benign Het
Oser1 A T 2: 163,411,416 S58T possibly damaging Het
Pcdha5 T A 18: 36,961,503 I355N possibly damaging Het
Pllp C G 8: 94,676,176 G99A probably damaging Het
Pram1 A G 17: 33,642,132 N509S probably benign Het
Prkd1 A C 12: 50,425,517 N204K probably damaging Het
Prss23 G A 7: 89,510,045 P272L probably damaging Het
Pxdn T C 12: 30,005,825 F1057L probably damaging Het
Rapgef5 T A 12: 117,755,967 S777R probably benign Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rfx3 A T 19: 27,826,048 M265K probably benign Het
S100a7a C A 3: 90,657,812 H105N probably benign Het
Serpinb3b T C 1: 107,156,895 D132G probably damaging Het
Sp7 T A 15: 102,366,387 probably benign Het
Tacstd2 A G 6: 67,535,156 F184S possibly damaging Het
Trdc C A 14: 54,143,802 probably benign Het
Trpa1 T A 1: 14,904,262 H232L probably benign Het
Trpc3 G T 3: 36,655,145 T394K probably benign Het
Tuba3b G A 6: 145,621,121 V363I possibly damaging Het
Tubb2a C A 13: 34,074,979 R276L probably benign Het
Ubap2l A T 3: 90,043,764 L72* probably null Het
Vps13a A T 19: 16,725,572 D672E probably damaging Het
Wdr26 A G 1: 181,209,073 V166A probably benign Het
Wwox T C 8: 114,712,036 S281P probably damaging Het
Xirp2 G A 2: 67,509,412 G666R probably damaging Het
Zfp131 T C 13: 119,775,980 K247E probably damaging Het
Other mutations in Map3k11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02017:Map3k11 APN 19 5697623 missense possibly damaging 0.91
IGL02581:Map3k11 APN 19 5700806 missense probably benign
R0130:Map3k11 UTSW 19 5690815 missense probably damaging 1.00
R0193:Map3k11 UTSW 19 5695846 missense probably damaging 0.99
R1621:Map3k11 UTSW 19 5690806 missense probably damaging 1.00
R1736:Map3k11 UTSW 19 5697401 missense probably benign 0.34
R1791:Map3k11 UTSW 19 5695572 nonsense probably null
R3500:Map3k11 UTSW 19 5690247 start codon destroyed probably benign 0.08
R3836:Map3k11 UTSW 19 5690803 missense possibly damaging 0.71
R3892:Map3k11 UTSW 19 5702283 missense probably benign 0.13
R4303:Map3k11 UTSW 19 5690824 missense probably damaging 1.00
R4513:Map3k11 UTSW 19 5702210 missense probably damaging 0.97
R4613:Map3k11 UTSW 19 5697470 missense probably benign 0.18
R4613:Map3k11 UTSW 19 5697471 missense probably damaging 0.98
R4631:Map3k11 UTSW 19 5690913 missense probably benign 0.30
R4780:Map3k11 UTSW 19 5690938 missense probably damaging 0.99
R5213:Map3k11 UTSW 19 5690641 missense probably damaging 0.99
R5266:Map3k11 UTSW 19 5700594 missense probably benign 0.03
R5372:Map3k11 UTSW 19 5690962 missense probably damaging 1.00
R5736:Map3k11 UTSW 19 5696711 missense probably damaging 1.00
R5899:Map3k11 UTSW 19 5695909 critical splice donor site probably null
R6052:Map3k11 UTSW 19 5697402 missense probably benign 0.01
R6388:Map3k11 UTSW 19 5690251 missense probably damaging 0.96
R6623:Map3k11 UTSW 19 5695603 missense probably damaging 0.97
R6975:Map3k11 UTSW 19 5690727 missense possibly damaging 0.91
R7309:Map3k11 UTSW 19 5690458 missense probably damaging 0.99
R7771:Map3k11 UTSW 19 5690608 missense probably damaging 0.99
X0025:Map3k11 UTSW 19 5696195 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGAACATCCGAATCTCTGTCTC -3'
(R):5'- ATCAAACAGGCCCTGGATCTC -3'

Sequencing Primer
(F):5'- CCCTACAGCTTTGGAGTGC -3'
(R):5'- AAGGAGTCCCGTGGCATCTC -3'
Posted On2019-12-03