Incidental Mutation 'R7816:Trp53bp2'
ID601506
Institutional Source Beutler Lab
Gene Symbol Trp53bp2
Ensembl Gene ENSMUSG00000026510
Gene Nametransformation related protein 53 binding protein 2
Synonyms53BP2, ASPP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7816 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location182409172-182462432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 182448695 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 747 (E747G)
Ref Sequence ENSEMBL: ENSMUSP00000112508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117245]
Predicted Effect probably damaging
Transcript: ENSMUST00000117245
AA Change: E747G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112508
Gene: ENSMUSG00000026510
AA Change: E747G

DomainStartEndE-ValueType
PDB:2UWQ|A 4 89 1e-53 PDB
Blast:RA 10 91 7e-50 BLAST
coiled coil region 129 306 N/A INTRINSIC
low complexity region 401 412 N/A INTRINSIC
low complexity region 495 512 N/A INTRINSIC
PDB:4IRV|H 728 788 5e-25 PDB
low complexity region 865 890 N/A INTRINSIC
ANK 964 993 2.52e-6 SMART
ANK 997 1026 7.13e-6 SMART
SH3 1066 1124 6.2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191626
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ASPP (apoptosis-stimulating protein of p53) family of p53 interacting proteins. The protein contains four ankyrin repeats and an SH3 domain involved in protein-protein interactions. It is localized to the perinuclear region of the cytoplasm, and regulates apoptosis and cell growth through interactions with other regulatory molecules including members of the p53 family. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation is lethal by 30 days of age, although majority die embryonically. Heterozygotes show increased susceptibility to spontaneous and induced tumors of the lymphoma and sarcoma types [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,292,429 S1321P probably benign Het
Abcb1a T C 5: 8,686,132 V175A possibly damaging Het
Adamts20 T A 15: 94,322,844 M1403L probably benign Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Amotl2 T A 9: 102,731,654 I789K probably benign Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bcar3 C T 3: 122,426,694 T80I probably benign Het
Bcas1 G T 2: 170,406,427 F181L probably benign Het
Cacnb1 T C 11: 98,005,289 E389G probably damaging Het
Cd52 A T 4: 134,093,888 probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Coro2a T C 4: 46,546,809 D182G probably benign Het
Crp T C 1: 172,698,710 S121P possibly damaging Het
Csnka2ip T C 16: 64,479,489 probably benign Het
Cttnbp2 T C 6: 18,448,414 D82G probably damaging Het
Cyp2b9 A G 7: 26,201,092 N385S probably benign Het
Dppa1 A G 11: 46,616,176 S26P possibly damaging Het
Eif4e3 T C 6: 99,640,638 R91G probably damaging Het
F13a1 A T 13: 37,025,771 N73K probably benign Het
Fbxl13 T C 5: 21,543,787 Y378C probably benign Het
Glis2 G A 16: 4,613,464 R285H probably damaging Het
Gm13089 G T 4: 143,698,194 N226K probably benign Het
Gm17174 T A 14: 51,592,112 probably benign Het
Gm5771 T C 6: 41,394,773 L51P probably damaging Het
Golga1 G A 2: 39,052,098 S102F probably damaging Het
Hdac1 A T 4: 129,518,095 Y336N probably damaging Het
Hfe G T 13: 23,704,399 T168K possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv1-56 T C 12: 115,243,226 S4G probably benign Het
Ino80d A G 1: 63,086,397 Y74H probably damaging Het
Ints1 A T 5: 139,771,379 H427Q possibly damaging Het
Itpkb T A 1: 180,413,889 V708E probably damaging Het
Jmjd4 G T 11: 59,450,336 G31V probably benign Het
Kcnh5 C T 12: 74,976,683 C537Y probably damaging Het
Kcnj11 A T 7: 46,099,857 L14Q probably damaging Het
Lipo4 A T 19: 33,514,242 W114R probably damaging Het
Lrrc9 T A 12: 72,495,692 I1096N probably damaging Het
Lyzl6 C T 11: 103,636,854 V15I probably benign Het
Map4k4 A G 1: 40,014,208 T856A possibly damaging Het
Mks1 T A 11: 87,860,716 W346R probably damaging Het
Mtmr14 T C 6: 113,266,302 Y32H probably damaging Het
Muc13 A G 16: 33,799,016 S45G unknown Het
Mx2 G A 16: 97,545,612 G93D probably damaging Het
Noc4l A T 5: 110,649,673 V365E probably benign Het
Odf2l T C 3: 145,151,015 I577T probably damaging Het
Olfr723 T C 14: 49,929,165 I126M probably damaging Het
Peg10 C CTCT 6: 4,756,453 probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pnoc A T 14: 65,401,858 I186N possibly damaging Het
Pou4f3 A G 18: 42,395,186 I65V probably benign Het
Ptpn21 G A 12: 98,682,532 A955V probably damaging Het
Rabgap1 G T 2: 37,563,464 R968L probably benign Het
Rarres1 T C 3: 67,479,344 N282S probably damaging Het
Rgs17 T C 10: 5,841,501 N72S probably benign Het
Rp1 T A 1: 4,347,703 N1062I probably damaging Het
Rpn1 T A 6: 88,103,396 V559D possibly damaging Het
Rrbp1 A T 2: 143,988,935 N437K probably damaging Het
Rtn4r C A 16: 18,151,535 Q276K probably benign Het
Rwdd4a T C 8: 47,537,300 S16P probably damaging Het
S1pr1 A G 3: 115,712,298 S216P possibly damaging Het
Scn8a C A 15: 101,011,036 T795K possibly damaging Het
Spryd3 A C 15: 102,117,706 F401C probably damaging Het
Stk36 G T 1: 74,611,169 E287* probably null Het
Tbc1d1 G T 5: 64,349,752 S1104I probably damaging Het
Tex15 A G 8: 33,581,655 D2410G probably benign Het
Tmem92 T A 11: 94,778,958 I116F possibly damaging Het
Trp63 A T 16: 25,889,240 D562V probably damaging Het
Ttc21b A G 2: 66,247,361 Y167H possibly damaging Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Uggt1 G A 1: 36,163,315 S1067F possibly damaging Het
Vmn2r103 T A 17: 19,794,214 Y423N probably benign Het
Vmn2r111 A G 17: 22,573,102 Y58H probably damaging Het
Ypel3 T A 7: 126,777,841 V2E probably damaging Het
Ythdf3 T C 3: 16,189,517 V34A probably damaging Het
Zfp180 A T 7: 24,105,145 S330C probably damaging Het
Zfp292 G A 4: 34,809,865 P1060S probably benign Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp981 C T 4: 146,537,643 R342C probably benign Het
Other mutations in Trp53bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Trp53bp2 APN 1 182440976 missense probably benign 0.17
IGL00920:Trp53bp2 APN 1 182444654 unclassified probably benign
IGL01336:Trp53bp2 APN 1 182431583 missense probably damaging 1.00
IGL01760:Trp53bp2 APN 1 182448428 missense possibly damaging 0.68
IGL02539:Trp53bp2 APN 1 182448691 missense probably damaging 0.99
IGL02609:Trp53bp2 APN 1 182453724 missense probably benign 0.21
IGL02720:Trp53bp2 APN 1 182453724 missense probably benign 0.21
IGL02962:Trp53bp2 APN 1 182431595 missense probably benign 0.00
IGL03348:Trp53bp2 APN 1 182453748 missense probably damaging 1.00
Nosa UTSW 1 182455740 missense probably damaging 1.00
R0012:Trp53bp2 UTSW 1 182444718 missense probably damaging 0.99
R0012:Trp53bp2 UTSW 1 182444718 missense probably damaging 0.99
R0347:Trp53bp2 UTSW 1 182441648 missense probably benign 0.08
R1422:Trp53bp2 UTSW 1 182446464 missense probably benign
R1833:Trp53bp2 UTSW 1 182429016 missense probably damaging 0.98
R1845:Trp53bp2 UTSW 1 182458903 missense probably damaging 1.00
R1893:Trp53bp2 UTSW 1 182431628 missense probably benign 0.01
R1927:Trp53bp2 UTSW 1 182452664 missense probably damaging 0.98
R2017:Trp53bp2 UTSW 1 182449015 missense probably benign
R2020:Trp53bp2 UTSW 1 182442819 missense probably damaging 1.00
R2072:Trp53bp2 UTSW 1 182458867 missense probably benign 0.00
R2120:Trp53bp2 UTSW 1 182441639 missense probably benign 0.06
R2504:Trp53bp2 UTSW 1 182441639 missense probably benign 0.26
R2970:Trp53bp2 UTSW 1 182431598 missense probably damaging 1.00
R3051:Trp53bp2 UTSW 1 182453782 missense probably damaging 0.96
R3052:Trp53bp2 UTSW 1 182453782 missense probably damaging 0.96
R3053:Trp53bp2 UTSW 1 182453782 missense probably damaging 0.96
R3151:Trp53bp2 UTSW 1 182428960 missense probably damaging 1.00
R4043:Trp53bp2 UTSW 1 182449061 missense possibly damaging 0.93
R4757:Trp53bp2 UTSW 1 182458774 missense probably benign 0.04
R4785:Trp53bp2 UTSW 1 182448997 missense probably benign
R4817:Trp53bp2 UTSW 1 182441805 critical splice donor site probably null
R4836:Trp53bp2 UTSW 1 182431582 missense probably damaging 1.00
R5040:Trp53bp2 UTSW 1 182444706 missense probably damaging 1.00
R5882:Trp53bp2 UTSW 1 182442212 missense possibly damaging 0.87
R6007:Trp53bp2 UTSW 1 182455740 missense probably damaging 1.00
R6356:Trp53bp2 UTSW 1 182448997 missense probably benign
R6886:Trp53bp2 UTSW 1 182429043 critical splice donor site probably null
R6987:Trp53bp2 UTSW 1 182446635 missense probably damaging 0.99
R7026:Trp53bp2 UTSW 1 182442735 missense probably benign
R7141:Trp53bp2 UTSW 1 182448508 missense
R7363:Trp53bp2 UTSW 1 182444666 missense probably damaging 0.99
R7452:Trp53bp2 UTSW 1 182446568 nonsense probably null
R7838:Trp53bp2 UTSW 1 182455819 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGTTTCTTCAGTTCATGAGAGC -3'
(R):5'- ACTGTTCTCCGTACTGGCAC -3'

Sequencing Primer
(F):5'- GCCATGAAAACGAAAGGATTCCTCG -3'
(R):5'- GTTCAGGGACTAAAGAGCCCAC -3'
Posted On2019-12-03