Incidental Mutation 'R7816:Golga1'
ID601508
Institutional Source Beutler Lab
Gene Symbol Golga1
Ensembl Gene ENSMUSG00000026754
Gene Namegolgi autoantigen, golgin subfamily a, 1
Synonyms0710001G09Rik, Golgi97, golgin-97, 2210418B03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R7816 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location39016155-39065541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 39052098 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 102 (S102F)
Ref Sequence ENSEMBL: ENSMUSP00000139001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039165] [ENSMUST00000112850] [ENSMUST00000149810] [ENSMUST00000184996]
Predicted Effect probably damaging
Transcript: ENSMUST00000039165
AA Change: S102F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037735
Gene: ENSMUSG00000026754
AA Change: S102F

DomainStartEndE-ValueType
coiled coil region 51 104 N/A INTRINSIC
coiled coil region 126 169 N/A INTRINSIC
coiled coil region 190 555 N/A INTRINSIC
coiled coil region 599 647 N/A INTRINSIC
Grip 682 728 5.68e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112850
AA Change: S77F

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108471
Gene: ENSMUSG00000026754
AA Change: S77F

DomainStartEndE-ValueType
coiled coil region 53 144 N/A INTRINSIC
coiled coil region 165 530 N/A INTRINSIC
coiled coil region 574 622 N/A INTRINSIC
Grip 657 703 5.68e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000149810
AA Change: S46F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145206
Gene: ENSMUSG00000026754
AA Change: S46F

DomainStartEndE-ValueType
coiled coil region 1 48 N/A INTRINSIC
coiled coil region 70 183 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153914
AA Change: S19F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000184996
AA Change: S102F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139001
Gene: ENSMUSG00000026754
AA Change: S102F

DomainStartEndE-ValueType
coiled coil region 51 104 N/A INTRINSIC
coiled coil region 126 169 N/A INTRINSIC
coiled coil region 190 555 N/A INTRINSIC
coiled coil region 599 647 N/A INTRINSIC
Grip 682 728 5.68e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This encoded protein is associated with Sjogren's syndrome. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous mice exhibit tremors and limb grasping behavior at two months of age. A variable severity of hearing loss was also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,292,429 S1321P probably benign Het
Abcb1a T C 5: 8,686,132 V175A possibly damaging Het
Adamts20 T A 15: 94,322,844 M1403L probably benign Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Amotl2 T A 9: 102,731,654 I789K probably benign Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bcar3 C T 3: 122,426,694 T80I probably benign Het
Bcas1 G T 2: 170,406,427 F181L probably benign Het
Cacnb1 T C 11: 98,005,289 E389G probably damaging Het
Cd52 A T 4: 134,093,888 probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Coro2a T C 4: 46,546,809 D182G probably benign Het
Crp T C 1: 172,698,710 S121P possibly damaging Het
Csnka2ip T C 16: 64,479,489 probably benign Het
Cttnbp2 T C 6: 18,448,414 D82G probably damaging Het
Cyp2b9 A G 7: 26,201,092 N385S probably benign Het
Dppa1 A G 11: 46,616,176 S26P possibly damaging Het
Eif4e3 T C 6: 99,640,638 R91G probably damaging Het
F13a1 A T 13: 37,025,771 N73K probably benign Het
Fbxl13 T C 5: 21,543,787 Y378C probably benign Het
Glis2 G A 16: 4,613,464 R285H probably damaging Het
Gm13089 G T 4: 143,698,194 N226K probably benign Het
Gm17174 T A 14: 51,592,112 probably benign Het
Gm5771 T C 6: 41,394,773 L51P probably damaging Het
Hdac1 A T 4: 129,518,095 Y336N probably damaging Het
Hfe G T 13: 23,704,399 T168K possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv1-56 T C 12: 115,243,226 S4G probably benign Het
Ino80d A G 1: 63,086,397 Y74H probably damaging Het
Ints1 A T 5: 139,771,379 H427Q possibly damaging Het
Itpkb T A 1: 180,413,889 V708E probably damaging Het
Jmjd4 G T 11: 59,450,336 G31V probably benign Het
Kcnh5 C T 12: 74,976,683 C537Y probably damaging Het
Kcnj11 A T 7: 46,099,857 L14Q probably damaging Het
Lipo4 A T 19: 33,514,242 W114R probably damaging Het
Lrrc9 T A 12: 72,495,692 I1096N probably damaging Het
Lyzl6 C T 11: 103,636,854 V15I probably benign Het
Map4k4 A G 1: 40,014,208 T856A possibly damaging Het
Mks1 T A 11: 87,860,716 W346R probably damaging Het
Mtmr14 T C 6: 113,266,302 Y32H probably damaging Het
Muc13 A G 16: 33,799,016 S45G unknown Het
Mx2 G A 16: 97,545,612 G93D probably damaging Het
Noc4l A T 5: 110,649,673 V365E probably benign Het
Odf2l T C 3: 145,151,015 I577T probably damaging Het
Olfr723 T C 14: 49,929,165 I126M probably damaging Het
Peg10 C CTCT 6: 4,756,453 probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pnoc A T 14: 65,401,858 I186N possibly damaging Het
Pou4f3 A G 18: 42,395,186 I65V probably benign Het
Ptpn21 G A 12: 98,682,532 A955V probably damaging Het
Rabgap1 G T 2: 37,563,464 R968L probably benign Het
Rarres1 T C 3: 67,479,344 N282S probably damaging Het
Rgs17 T C 10: 5,841,501 N72S probably benign Het
Rp1 T A 1: 4,347,703 N1062I probably damaging Het
Rpn1 T A 6: 88,103,396 V559D possibly damaging Het
Rrbp1 A T 2: 143,988,935 N437K probably damaging Het
Rtn4r C A 16: 18,151,535 Q276K probably benign Het
Rwdd4a T C 8: 47,537,300 S16P probably damaging Het
S1pr1 A G 3: 115,712,298 S216P possibly damaging Het
Scn8a C A 15: 101,011,036 T795K possibly damaging Het
Spryd3 A C 15: 102,117,706 F401C probably damaging Het
Stk36 G T 1: 74,611,169 E287* probably null Het
Tbc1d1 G T 5: 64,349,752 S1104I probably damaging Het
Tex15 A G 8: 33,581,655 D2410G probably benign Het
Tmem92 T A 11: 94,778,958 I116F possibly damaging Het
Trp53bp2 A G 1: 182,448,695 E747G probably damaging Het
Trp63 A T 16: 25,889,240 D562V probably damaging Het
Ttc21b A G 2: 66,247,361 Y167H possibly damaging Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Uggt1 G A 1: 36,163,315 S1067F possibly damaging Het
Vmn2r103 T A 17: 19,794,214 Y423N probably benign Het
Vmn2r111 A G 17: 22,573,102 Y58H probably damaging Het
Ypel3 T A 7: 126,777,841 V2E probably damaging Het
Ythdf3 T C 3: 16,189,517 V34A probably damaging Het
Zfp180 A T 7: 24,105,145 S330C probably damaging Het
Zfp292 G A 4: 34,809,865 P1060S probably benign Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp981 C T 4: 146,537,643 R342C probably benign Het
Other mutations in Golga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Golga1 APN 2 39052973 nonsense probably null
IGL00949:Golga1 APN 2 39041255 missense probably damaging 0.98
IGL01133:Golga1 APN 2 39023472 missense probably benign
IGL01592:Golga1 APN 2 39063282 missense probably damaging 1.00
IGL01613:Golga1 APN 2 39020126 missense probably benign 0.14
IGL01819:Golga1 APN 2 39034149 missense probably benign 0.00
IGL01871:Golga1 APN 2 39050198 splice site probably benign
IGL02744:Golga1 APN 2 39018474 missense probably damaging 1.00
IGL02819:Golga1 APN 2 39039078 missense probably null 0.97
IGL02874:Golga1 APN 2 39039092 missense probably damaging 1.00
R0167:Golga1 UTSW 2 39047648 missense probably benign 0.00
R0245:Golga1 UTSW 2 39035259 missense probably benign 0.00
R0389:Golga1 UTSW 2 39018441 missense probably damaging 1.00
R0443:Golga1 UTSW 2 39018441 missense probably damaging 1.00
R0906:Golga1 UTSW 2 39047643 missense probably damaging 0.99
R1508:Golga1 UTSW 2 39023249 missense probably benign
R1901:Golga1 UTSW 2 39047780 splice site probably null
R1964:Golga1 UTSW 2 39047087 missense probably benign 0.00
R2228:Golga1 UTSW 2 39023171 missense probably benign 0.02
R3734:Golga1 UTSW 2 39050170 missense possibly damaging 0.88
R4407:Golga1 UTSW 2 39019641 splice site probably null
R4504:Golga1 UTSW 2 39023454 missense probably benign 0.00
R4973:Golga1 UTSW 2 39039106 missense probably damaging 0.99
R5049:Golga1 UTSW 2 39047735 missense probably damaging 1.00
R5600:Golga1 UTSW 2 39020099 missense probably damaging 1.00
R6008:Golga1 UTSW 2 39047087 missense probably benign 0.00
R6374:Golga1 UTSW 2 39034068 missense probably benign
R6388:Golga1 UTSW 2 39023171 missense probably benign 0.02
R6601:Golga1 UTSW 2 39020106 missense probably damaging 1.00
R7067:Golga1 UTSW 2 39047719 missense probably benign 0.00
X0025:Golga1 UTSW 2 39052062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACTTTTATCAGGTCTGTGTCATG -3'
(R):5'- CACCTACCTTAAGTGTTTGTCATG -3'

Sequencing Primer
(F):5'- ATCAGGTCTGTGTCATGATTTTTAAG -3'
(R):5'- GTAAGGACTCAGAGCCTTACCAG -3'
Posted On2019-12-03