Incidental Mutation 'R7816:Rarres1'
ID601513
Institutional Source Beutler Lab
Gene Symbol Rarres1
Ensembl Gene ENSMUSG00000049404
Gene Nameretinoic acid receptor responder (tazarotene induced) 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R7816 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location67478972-67515523 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67479344 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 282 (N282S)
Ref Sequence ENSEMBL: ENSMUSP00000056728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054825] [ENSMUST00000077271]
Predicted Effect probably damaging
Transcript: ENSMUST00000054825
AA Change: N282S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000056728
Gene: ENSMUSG00000049404
AA Change: N282S

DomainStartEndE-ValueType
low complexity region 45 62 N/A INTRINSIC
Pfam:Latexin 81 299 8e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077271
SMART Domains Protein: ENSMUSP00000076503
Gene: ENSMUSG00000027774

DomainStartEndE-ValueType
Pfam:GTP_EFTU 45 320 3.5e-65 PFAM
Pfam:GTP_EFTU_D2 366 432 6e-18 PFAM
Pfam:EFG_II 446 520 1.9e-31 PFAM
EFG_IV 522 642 1.64e-47 SMART
EFG_C 644 731 2.16e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a retinoid acid (RA) receptor-responsive gene. It encodes a type 1 membrane protein. The expression of this gene is upregulated by tazarotene as well as by retinoic acid receptors. The expression of this gene is found to be downregulated in prostate cancer, which is caused by the methylation of its promoter and CpG island. Alternatively spliced transcript variant encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,292,429 S1321P probably benign Het
Abcb1a T C 5: 8,686,132 V175A possibly damaging Het
Adamts20 T A 15: 94,322,844 M1403L probably benign Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Amotl2 T A 9: 102,731,654 I789K probably benign Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bcar3 C T 3: 122,426,694 T80I probably benign Het
Bcas1 G T 2: 170,406,427 F181L probably benign Het
Cacnb1 T C 11: 98,005,289 E389G probably damaging Het
Cd52 A T 4: 134,093,888 probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Coro2a T C 4: 46,546,809 D182G probably benign Het
Crp T C 1: 172,698,710 S121P possibly damaging Het
Csnka2ip T C 16: 64,479,489 probably benign Het
Cttnbp2 T C 6: 18,448,414 D82G probably damaging Het
Cyp2b9 A G 7: 26,201,092 N385S probably benign Het
Dppa1 A G 11: 46,616,176 S26P possibly damaging Het
Eif4e3 T C 6: 99,640,638 R91G probably damaging Het
F13a1 A T 13: 37,025,771 N73K probably benign Het
Fbxl13 T C 5: 21,543,787 Y378C probably benign Het
Glis2 G A 16: 4,613,464 R285H probably damaging Het
Gm13089 G T 4: 143,698,194 N226K probably benign Het
Gm17174 T A 14: 51,592,112 probably benign Het
Gm5771 T C 6: 41,394,773 L51P probably damaging Het
Golga1 G A 2: 39,052,098 S102F probably damaging Het
Hdac1 A T 4: 129,518,095 Y336N probably damaging Het
Hfe G T 13: 23,704,399 T168K possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv1-56 T C 12: 115,243,226 S4G probably benign Het
Ino80d A G 1: 63,086,397 Y74H probably damaging Het
Ints1 A T 5: 139,771,379 H427Q possibly damaging Het
Itpkb T A 1: 180,413,889 V708E probably damaging Het
Jmjd4 G T 11: 59,450,336 G31V probably benign Het
Kcnh5 C T 12: 74,976,683 C537Y probably damaging Het
Kcnj11 A T 7: 46,099,857 L14Q probably damaging Het
Lipo4 A T 19: 33,514,242 W114R probably damaging Het
Lrrc9 T A 12: 72,495,692 I1096N probably damaging Het
Lyzl6 C T 11: 103,636,854 V15I probably benign Het
Map4k4 A G 1: 40,014,208 T856A possibly damaging Het
Mks1 T A 11: 87,860,716 W346R probably damaging Het
Mtmr14 T C 6: 113,266,302 Y32H probably damaging Het
Muc13 A G 16: 33,799,016 S45G unknown Het
Mx2 G A 16: 97,545,612 G93D probably damaging Het
Noc4l A T 5: 110,649,673 V365E probably benign Het
Odf2l T C 3: 145,151,015 I577T probably damaging Het
Olfr723 T C 14: 49,929,165 I126M probably damaging Het
Peg10 C CTCT 6: 4,756,453 probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pnoc A T 14: 65,401,858 I186N possibly damaging Het
Pou4f3 A G 18: 42,395,186 I65V probably benign Het
Ptpn21 G A 12: 98,682,532 A955V probably damaging Het
Rabgap1 G T 2: 37,563,464 R968L probably benign Het
Rgs17 T C 10: 5,841,501 N72S probably benign Het
Rp1 T A 1: 4,347,703 N1062I probably damaging Het
Rpn1 T A 6: 88,103,396 V559D possibly damaging Het
Rrbp1 A T 2: 143,988,935 N437K probably damaging Het
Rtn4r C A 16: 18,151,535 Q276K probably benign Het
Rwdd4a T C 8: 47,537,300 S16P probably damaging Het
S1pr1 A G 3: 115,712,298 S216P possibly damaging Het
Scn8a C A 15: 101,011,036 T795K possibly damaging Het
Spryd3 A C 15: 102,117,706 F401C probably damaging Het
Stk36 G T 1: 74,611,169 E287* probably null Het
Tbc1d1 G T 5: 64,349,752 S1104I probably damaging Het
Tex15 A G 8: 33,581,655 D2410G probably benign Het
Tmem92 T A 11: 94,778,958 I116F possibly damaging Het
Trp53bp2 A G 1: 182,448,695 E747G probably damaging Het
Trp63 A T 16: 25,889,240 D562V probably damaging Het
Ttc21b A G 2: 66,247,361 Y167H possibly damaging Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Uggt1 G A 1: 36,163,315 S1067F possibly damaging Het
Vmn2r103 T A 17: 19,794,214 Y423N probably benign Het
Vmn2r111 A G 17: 22,573,102 Y58H probably damaging Het
Ypel3 T A 7: 126,777,841 V2E probably damaging Het
Ythdf3 T C 3: 16,189,517 V34A probably damaging Het
Zfp180 A T 7: 24,105,145 S330C probably damaging Het
Zfp292 G A 4: 34,809,865 P1060S probably benign Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp981 C T 4: 146,537,643 R342C probably benign Het
Other mutations in Rarres1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02175:Rarres1 APN 3 67495756 missense probably benign 0.13
IGL03115:Rarres1 APN 3 67495812 critical splice acceptor site probably null
R3815:Rarres1 UTSW 3 67515321 missense probably benign 0.00
R3979:Rarres1 UTSW 3 67495810 missense probably benign 0.13
R6586:Rarres1 UTSW 3 67491033 missense probably damaging 1.00
R7286:Rarres1 UTSW 3 67515184 missense probably benign
R7696:Rarres1 UTSW 3 67491012 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGAAACCTTTTCCCAAAGCAATTG -3'
(R):5'- AATTCTCCACACAGGTAAGATGC -3'

Sequencing Primer
(F):5'- CCCAAAGCAATTGTTGATCCATCTG -3'
(R):5'- CTCCACACAGGTAAGATGCAAAGTTG -3'
Posted On2019-12-03