Incidental Mutation 'R7816:Zfp981'
ID601522
Institutional Source Beutler Lab
Gene Symbol Zfp981
Ensembl Gene ENSMUSG00000056300
Gene Namezinc finger protein 981
SynonymsGm13247
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R7816 (G1)
Quality Score114.008
Status Not validated
Chromosome4
Chromosomal Location146502027-146539395 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 146537643 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 342 (R342C)
Ref Sequence ENSEMBL: ENSMUSP00000101361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105735] [ENSMUST00000140089] [ENSMUST00000179175]
Predicted Effect probably benign
Transcript: ENSMUST00000105735
AA Change: R342C

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101361
Gene: ENSMUSG00000056300
AA Change: R342C

DomainStartEndE-ValueType
KRAB 13 73 2.34e-15 SMART
ZnF_C2H2 239 261 7.9e-4 SMART
ZnF_C2H2 267 289 8.6e-5 SMART
ZnF_C2H2 295 317 8.6e-5 SMART
ZnF_C2H2 323 345 1.36e-2 SMART
ZnF_C2H2 351 373 6.32e-3 SMART
ZnF_C2H2 379 401 8.6e-5 SMART
ZnF_C2H2 407 429 3.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140089
SMART Domains Protein: ENSMUSP00000115886
Gene: ENSMUSG00000056300

DomainStartEndE-ValueType
KRAB 13 73 2.34e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179175
AA Change: R342C

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000136739
Gene: ENSMUSG00000056300
AA Change: R342C

DomainStartEndE-ValueType
KRAB 13 73 2.34e-15 SMART
ZnF_C2H2 239 261 7.9e-4 SMART
ZnF_C2H2 267 289 8.6e-5 SMART
ZnF_C2H2 295 317 8.6e-5 SMART
ZnF_C2H2 323 345 1.36e-2 SMART
ZnF_C2H2 351 373 6.32e-3 SMART
ZnF_C2H2 379 401 8.6e-5 SMART
ZnF_C2H2 407 429 3.11e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,292,429 S1321P probably benign Het
Abcb1a T C 5: 8,686,132 V175A possibly damaging Het
Adamts20 T A 15: 94,322,844 M1403L probably benign Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Amotl2 T A 9: 102,731,654 I789K probably benign Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bcar3 C T 3: 122,426,694 T80I probably benign Het
Bcas1 G T 2: 170,406,427 F181L probably benign Het
Cacnb1 T C 11: 98,005,289 E389G probably damaging Het
Cd52 A T 4: 134,093,888 probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Coro2a T C 4: 46,546,809 D182G probably benign Het
Crp T C 1: 172,698,710 S121P possibly damaging Het
Csnka2ip T C 16: 64,479,489 probably benign Het
Cttnbp2 T C 6: 18,448,414 D82G probably damaging Het
Cyp2b9 A G 7: 26,201,092 N385S probably benign Het
Dppa1 A G 11: 46,616,176 S26P possibly damaging Het
Eif4e3 T C 6: 99,640,638 R91G probably damaging Het
F13a1 A T 13: 37,025,771 N73K probably benign Het
Fbxl13 T C 5: 21,543,787 Y378C probably benign Het
Glis2 G A 16: 4,613,464 R285H probably damaging Het
Gm13089 G T 4: 143,698,194 N226K probably benign Het
Gm17174 T A 14: 51,592,112 probably benign Het
Gm5771 T C 6: 41,394,773 L51P probably damaging Het
Golga1 G A 2: 39,052,098 S102F probably damaging Het
Hdac1 A T 4: 129,518,095 Y336N probably damaging Het
Hfe G T 13: 23,704,399 T168K possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv1-56 T C 12: 115,243,226 S4G probably benign Het
Ino80d A G 1: 63,086,397 Y74H probably damaging Het
Ints1 A T 5: 139,771,379 H427Q possibly damaging Het
Itpkb T A 1: 180,413,889 V708E probably damaging Het
Jmjd4 G T 11: 59,450,336 G31V probably benign Het
Kcnh5 C T 12: 74,976,683 C537Y probably damaging Het
Kcnj11 A T 7: 46,099,857 L14Q probably damaging Het
Lipo4 A T 19: 33,514,242 W114R probably damaging Het
Lrrc9 T A 12: 72,495,692 I1096N probably damaging Het
Lyzl6 C T 11: 103,636,854 V15I probably benign Het
Map4k4 A G 1: 40,014,208 T856A possibly damaging Het
Mks1 T A 11: 87,860,716 W346R probably damaging Het
Mtmr14 T C 6: 113,266,302 Y32H probably damaging Het
Muc13 A G 16: 33,799,016 S45G unknown Het
Mx2 G A 16: 97,545,612 G93D probably damaging Het
Noc4l A T 5: 110,649,673 V365E probably benign Het
Odf2l T C 3: 145,151,015 I577T probably damaging Het
Olfr723 T C 14: 49,929,165 I126M probably damaging Het
Peg10 C CTCT 6: 4,756,453 probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pnoc A T 14: 65,401,858 I186N possibly damaging Het
Pou4f3 A G 18: 42,395,186 I65V probably benign Het
Ptpn21 G A 12: 98,682,532 A955V probably damaging Het
Rabgap1 G T 2: 37,563,464 R968L probably benign Het
Rarres1 T C 3: 67,479,344 N282S probably damaging Het
Rgs17 T C 10: 5,841,501 N72S probably benign Het
Rp1 T A 1: 4,347,703 N1062I probably damaging Het
Rpn1 T A 6: 88,103,396 V559D possibly damaging Het
Rrbp1 A T 2: 143,988,935 N437K probably damaging Het
Rtn4r C A 16: 18,151,535 Q276K probably benign Het
Rwdd4a T C 8: 47,537,300 S16P probably damaging Het
S1pr1 A G 3: 115,712,298 S216P possibly damaging Het
Scn8a C A 15: 101,011,036 T795K possibly damaging Het
Spryd3 A C 15: 102,117,706 F401C probably damaging Het
Stk36 G T 1: 74,611,169 E287* probably null Het
Tbc1d1 G T 5: 64,349,752 S1104I probably damaging Het
Tex15 A G 8: 33,581,655 D2410G probably benign Het
Tmem92 T A 11: 94,778,958 I116F possibly damaging Het
Trp53bp2 A G 1: 182,448,695 E747G probably damaging Het
Trp63 A T 16: 25,889,240 D562V probably damaging Het
Ttc21b A G 2: 66,247,361 Y167H possibly damaging Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Uggt1 G A 1: 36,163,315 S1067F possibly damaging Het
Vmn2r103 T A 17: 19,794,214 Y423N probably benign Het
Vmn2r111 A G 17: 22,573,102 Y58H probably damaging Het
Ypel3 T A 7: 126,777,841 V2E probably damaging Het
Ythdf3 T C 3: 16,189,517 V34A probably damaging Het
Zfp180 A T 7: 24,105,145 S330C probably damaging Het
Zfp292 G A 4: 34,809,865 P1060S probably benign Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Other mutations in Zfp981
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02647:Zfp981 APN 4 146537252 nonsense probably null
R0003:Zfp981 UTSW 4 146537760 missense probably damaging 1.00
R1172:Zfp981 UTSW 4 146537764 missense probably benign
R2989:Zfp981 UTSW 4 146537890 missense probably benign 0.40
R4158:Zfp981 UTSW 4 146537623 missense probably benign
R4158:Zfp981 UTSW 4 146537882 missense probably benign 0.07
R4778:Zfp981 UTSW 4 146537655 missense probably benign
R5148:Zfp981 UTSW 4 146536900 missense possibly damaging 0.86
R5352:Zfp981 UTSW 4 146537005 missense probably benign 0.29
R6252:Zfp981 UTSW 4 146537513 missense probably benign 0.22
R6674:Zfp981 UTSW 4 146535493 missense probably damaging 0.98
R6765:Zfp981 UTSW 4 146537906 missense probably benign 0.34
R7288:Zfp981 UTSW 4 146537643 missense probably benign 0.32
R7835:Zfp981 UTSW 4 146537876 missense probably benign 0.01
R8020:Zfp981 UTSW 4 146537368 missense possibly damaging 0.91
Z1176:Zfp981 UTSW 4 146537090 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCTGAGAGTTCATCAGAGAATTCA -3'
(R):5'- TGCCTTCTCAGAGTGAGTTTGTC -3'

Sequencing Primer
(F):5'- TCATCAGAGAATTCATACTGGAGAG -3'
(R):5'- CTCAGAGTGAGTTTGTCAGTAAAGC -3'
Posted On2019-12-03