Incidental Mutation 'R7816:Tex15'
ID601540
Institutional Source Beutler Lab
Gene Symbol Tex15
Ensembl Gene ENSMUSG00000009628
Gene Nametestis expressed gene 15
Synonyms2210014E14Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_031374.2; MGI: 1934816

Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R7816 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location33516738-33585582 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33581655 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2410 (D2410G)
Ref Sequence ENSEMBL: ENSMUSP00000009772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009772] [ENSMUST00000124501]
Predicted Effect probably benign
Transcript: ENSMUST00000009772
AA Change: D2410G

PolyPhen 2 Score 0.145 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000009772
Gene: ENSMUSG00000009628
AA Change: D2410G

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
low complexity region 302 313 N/A INTRINSIC
low complexity region 524 536 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
low complexity region 713 725 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
low complexity region 1497 1508 N/A INTRINSIC
Pfam:TEX15 1572 1788 1.3e-109 PFAM
Pfam:TEX15 1901 2119 1.1e-16 PFAM
low complexity region 2758 2770 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124501
SMART Domains Protein: ENSMUSP00000138070
Gene: ENSMUSG00000009628

DomainStartEndE-ValueType
Pfam:DUF3715 96 251 2.4e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype Strain: 3526165
PHENOTYPE: Male mice are infertile due to arrest of meiosis stemming from failure to repair double-strand breaks. However, female mice are fertile. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,292,429 S1321P probably benign Het
Abcb1a T C 5: 8,686,132 V175A possibly damaging Het
Adamts20 T A 15: 94,322,844 M1403L probably benign Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Amotl2 T A 9: 102,731,654 I789K probably benign Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bcar3 C T 3: 122,426,694 T80I probably benign Het
Bcas1 G T 2: 170,406,427 F181L probably benign Het
Cacnb1 T C 11: 98,005,289 E389G probably damaging Het
Cd52 A T 4: 134,093,888 probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Coro2a T C 4: 46,546,809 D182G probably benign Het
Crp T C 1: 172,698,710 S121P possibly damaging Het
Csnka2ip T C 16: 64,479,489 probably benign Het
Cttnbp2 T C 6: 18,448,414 D82G probably damaging Het
Cyp2b9 A G 7: 26,201,092 N385S probably benign Het
Dppa1 A G 11: 46,616,176 S26P possibly damaging Het
Eif4e3 T C 6: 99,640,638 R91G probably damaging Het
F13a1 A T 13: 37,025,771 N73K probably benign Het
Fbxl13 T C 5: 21,543,787 Y378C probably benign Het
Glis2 G A 16: 4,613,464 R285H probably damaging Het
Gm13089 G T 4: 143,698,194 N226K probably benign Het
Gm17174 T A 14: 51,592,112 probably benign Het
Gm5771 T C 6: 41,394,773 L51P probably damaging Het
Golga1 G A 2: 39,052,098 S102F probably damaging Het
Hdac1 A T 4: 129,518,095 Y336N probably damaging Het
Hfe G T 13: 23,704,399 T168K possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv1-56 T C 12: 115,243,226 S4G probably benign Het
Ino80d A G 1: 63,086,397 Y74H probably damaging Het
Ints1 A T 5: 139,771,379 H427Q possibly damaging Het
Itpkb T A 1: 180,413,889 V708E probably damaging Het
Jmjd4 G T 11: 59,450,336 G31V probably benign Het
Kcnh5 C T 12: 74,976,683 C537Y probably damaging Het
Kcnj11 A T 7: 46,099,857 L14Q probably damaging Het
Lipo4 A T 19: 33,514,242 W114R probably damaging Het
Lrrc9 T A 12: 72,495,692 I1096N probably damaging Het
Lyzl6 C T 11: 103,636,854 V15I probably benign Het
Map4k4 A G 1: 40,014,208 T856A possibly damaging Het
Mks1 T A 11: 87,860,716 W346R probably damaging Het
Mtmr14 T C 6: 113,266,302 Y32H probably damaging Het
Muc13 A G 16: 33,799,016 S45G unknown Het
Mx2 G A 16: 97,545,612 G93D probably damaging Het
Noc4l A T 5: 110,649,673 V365E probably benign Het
Odf2l T C 3: 145,151,015 I577T probably damaging Het
Olfr723 T C 14: 49,929,165 I126M probably damaging Het
Peg10 C CTCT 6: 4,756,453 probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pnoc A T 14: 65,401,858 I186N possibly damaging Het
Pou4f3 A G 18: 42,395,186 I65V probably benign Het
Ptpn21 G A 12: 98,682,532 A955V probably damaging Het
Rabgap1 G T 2: 37,563,464 R968L probably benign Het
Rarres1 T C 3: 67,479,344 N282S probably damaging Het
Rgs17 T C 10: 5,841,501 N72S probably benign Het
Rp1 T A 1: 4,347,703 N1062I probably damaging Het
Rpn1 T A 6: 88,103,396 V559D possibly damaging Het
Rrbp1 A T 2: 143,988,935 N437K probably damaging Het
Rtn4r C A 16: 18,151,535 Q276K probably benign Het
Rwdd4a T C 8: 47,537,300 S16P probably damaging Het
S1pr1 A G 3: 115,712,298 S216P possibly damaging Het
Scn8a C A 15: 101,011,036 T795K possibly damaging Het
Spryd3 A C 15: 102,117,706 F401C probably damaging Het
Stk36 G T 1: 74,611,169 E287* probably null Het
Tbc1d1 G T 5: 64,349,752 S1104I probably damaging Het
Tmem92 T A 11: 94,778,958 I116F possibly damaging Het
Trp53bp2 A G 1: 182,448,695 E747G probably damaging Het
Trp63 A T 16: 25,889,240 D562V probably damaging Het
Ttc21b A G 2: 66,247,361 Y167H possibly damaging Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Uggt1 G A 1: 36,163,315 S1067F possibly damaging Het
Vmn2r103 T A 17: 19,794,214 Y423N probably benign Het
Vmn2r111 A G 17: 22,573,102 Y58H probably damaging Het
Ypel3 T A 7: 126,777,841 V2E probably damaging Het
Ythdf3 T C 3: 16,189,517 V34A probably damaging Het
Zfp180 A T 7: 24,105,145 S330C probably damaging Het
Zfp292 G A 4: 34,809,865 P1060S probably benign Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp981 C T 4: 146,537,643 R342C probably benign Het
Other mutations in Tex15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Tex15 APN 8 33575311 missense probably benign 0.18
IGL00705:Tex15 APN 8 33581592 missense probably damaging 1.00
IGL00820:Tex15 APN 8 33579006 splice site probably benign
IGL01288:Tex15 APN 8 33571384 missense probably benign 0.02
IGL01328:Tex15 APN 8 33571396 nonsense probably null
IGL01359:Tex15 APN 8 33581898 missense probably damaging 0.99
IGL01603:Tex15 APN 8 33573547 missense possibly damaging 0.93
IGL01861:Tex15 APN 8 33570689 missense probably damaging 1.00
IGL02052:Tex15 APN 8 33582465 missense probably benign 0.28
IGL02560:Tex15 APN 8 33581751 missense probably benign 0.00
IGL02677:Tex15 APN 8 33571080 missense probably benign 0.03
IGL02739:Tex15 APN 8 33581693 missense possibly damaging 0.68
Big_gulp UTSW 8 33581734 missense probably damaging 1.00
P0005:Tex15 UTSW 8 33570868 missense probably benign 0.00
P0037:Tex15 UTSW 8 33581580 missense probably benign 0.00
PIT4377001:Tex15 UTSW 8 33571101 missense probably damaging 1.00
R0056:Tex15 UTSW 8 33582027 missense probably benign 0.00
R0056:Tex15 UTSW 8 33582027 missense probably benign 0.00
R0058:Tex15 UTSW 8 33581502 splice site probably benign
R0058:Tex15 UTSW 8 33581502 splice site probably benign
R0595:Tex15 UTSW 8 33572617 missense probably damaging 1.00
R0646:Tex15 UTSW 8 33582326 missense possibly damaging 0.83
R0688:Tex15 UTSW 8 33573500 missense probably damaging 1.00
R0842:Tex15 UTSW 8 33571547 missense possibly damaging 0.95
R0987:Tex15 UTSW 8 33576847 missense probably damaging 1.00
R1084:Tex15 UTSW 8 33577004 missense probably benign 0.28
R1183:Tex15 UTSW 8 33574865 missense probably benign 0.35
R1186:Tex15 UTSW 8 33571633 missense probably benign 0.19
R1378:Tex15 UTSW 8 33575216 missense probably damaging 0.99
R1500:Tex15 UTSW 8 33575092 missense probably damaging 0.96
R1508:Tex15 UTSW 8 33576852 missense probably damaging 1.00
R1597:Tex15 UTSW 8 33571483 missense probably damaging 0.96
R1636:Tex15 UTSW 8 33576387 nonsense probably null
R1639:Tex15 UTSW 8 33570817 missense possibly damaging 0.94
R1809:Tex15 UTSW 8 33574234 missense probably benign
R1843:Tex15 UTSW 8 33576654 missense probably benign 0.27
R2029:Tex15 UTSW 8 33571274 missense probably damaging 0.99
R2228:Tex15 UTSW 8 33571237 missense probably benign 0.05
R2229:Tex15 UTSW 8 33571237 missense probably benign 0.05
R2245:Tex15 UTSW 8 33571496 missense possibly damaging 0.77
R2246:Tex15 UTSW 8 33582512 missense possibly damaging 0.49
R2880:Tex15 UTSW 8 33574907 nonsense probably null
R2881:Tex15 UTSW 8 33574907 nonsense probably null
R2882:Tex15 UTSW 8 33574907 nonsense probably null
R3001:Tex15 UTSW 8 33574528 missense probably benign 0.15
R3002:Tex15 UTSW 8 33574528 missense probably benign 0.15
R3020:Tex15 UTSW 8 33576670 missense probably damaging 1.00
R3084:Tex15 UTSW 8 33574885 missense probably benign 0.11
R3085:Tex15 UTSW 8 33574885 missense probably benign 0.11
R3701:Tex15 UTSW 8 33574166 missense probably benign 0.00
R3702:Tex15 UTSW 8 33574166 missense probably benign 0.00
R3752:Tex15 UTSW 8 33571415 missense probably benign
R4162:Tex15 UTSW 8 33581558 missense probably damaging 1.00
R4231:Tex15 UTSW 8 33572137 missense probably damaging 0.99
R4589:Tex15 UTSW 8 33557373 missense probably damaging 1.00
R4707:Tex15 UTSW 8 33582497 missense probably benign 0.00
R4773:Tex15 UTSW 8 33582732 missense probably benign 0.42
R4967:Tex15 UTSW 8 33574470 missense probably benign 0.34
R5063:Tex15 UTSW 8 33582610 missense possibly damaging 0.59
R5121:Tex15 UTSW 8 33571766 missense probably damaging 1.00
R5147:Tex15 UTSW 8 33572312 nonsense probably null
R5166:Tex15 UTSW 8 33576392 missense probably benign 0.07
R5173:Tex15 UTSW 8 33571740 missense possibly damaging 0.73
R5439:Tex15 UTSW 8 33574171 missense possibly damaging 0.93
R5537:Tex15 UTSW 8 33571613 missense probably damaging 1.00
R5580:Tex15 UTSW 8 33572429 missense probably damaging 1.00
R5588:Tex15 UTSW 8 33577187 missense probably damaging 1.00
R5696:Tex15 UTSW 8 33573192 missense probably benign 0.01
R5734:Tex15 UTSW 8 33546336 missense probably benign 0.01
R5756:Tex15 UTSW 8 33575833 missense probably benign 0.17
R5823:Tex15 UTSW 8 33570934 missense possibly damaging 0.67
R6126:Tex15 UTSW 8 33573563 missense probably benign 0.19
R6129:Tex15 UTSW 8 33574130 missense possibly damaging 0.90
R6276:Tex15 UTSW 8 33577189 missense possibly damaging 0.93
R6374:Tex15 UTSW 8 33575912 missense probably damaging 1.00
R6430:Tex15 UTSW 8 33571301 missense probably benign 0.01
R6452:Tex15 UTSW 8 33572816 missense probably damaging 1.00
R6471:Tex15 UTSW 8 33581734 missense probably damaging 1.00
R6700:Tex15 UTSW 8 33574889 missense possibly damaging 0.93
R6918:Tex15 UTSW 8 33573184 missense probably benign 0.27
R6958:Tex15 UTSW 8 33570871 missense probably benign 0.01
R6970:Tex15 UTSW 8 33557428 missense probably benign 0.03
R7059:Tex15 UTSW 8 33574730 missense possibly damaging 0.57
R7069:Tex15 UTSW 8 33570720 missense probably benign
R7072:Tex15 UTSW 8 33575431 missense possibly damaging 0.85
R7212:Tex15 UTSW 8 33570826 nonsense probably null
R7212:Tex15 UTSW 8 33572995 missense probably damaging 1.00
R7216:Tex15 UTSW 8 33572986 missense possibly damaging 0.93
R7219:Tex15 UTSW 8 33546240 missense probably benign 0.40
R7313:Tex15 UTSW 8 33574817 missense possibly damaging 0.82
R7315:Tex15 UTSW 8 33581516 missense probably benign 0.01
R7444:Tex15 UTSW 8 33576562 missense possibly damaging 0.92
R7455:Tex15 UTSW 8 33576997 missense possibly damaging 0.91
R7643:Tex15 UTSW 8 33575120 missense probably damaging 1.00
R7644:Tex15 UTSW 8 33574417 missense probably benign 0.01
R7724:Tex15 UTSW 8 33546263 missense possibly damaging 0.60
R7779:Tex15 UTSW 8 33575281 missense probably damaging 1.00
R7798:Tex15 UTSW 8 33581847 missense possibly damaging 0.69
R7820:Tex15 UTSW 8 33575062 missense probably damaging 0.98
R8041:Tex15 UTSW 8 33575846 missense probably damaging 1.00
R8150:Tex15 UTSW 8 33573506 missense probably benign 0.06
R8152:Tex15 UTSW 8 33572893 missense possibly damaging 0.82
R8237:Tex15 UTSW 8 33577399 missense possibly damaging 0.72
R8250:Tex15 UTSW 8 33565205 missense probably null 0.27
R8264:Tex15 UTSW 8 33582362 missense probably benign 0.18
R8279:Tex15 UTSW 8 33571737 missense probably damaging 0.96
R8353:Tex15 UTSW 8 33576871 nonsense probably null
R8388:Tex15 UTSW 8 33575209 missense probably benign 0.00
R8432:Tex15 UTSW 8 33576544 missense probably damaging 0.99
R8453:Tex15 UTSW 8 33576871 nonsense probably null
R8489:Tex15 UTSW 8 33577546 missense probably benign 0.02
R8670:Tex15 UTSW 8 33574718 missense probably benign 0.19
R8703:Tex15 UTSW 8 33572696 missense probably benign 0.00
RF005:Tex15 UTSW 8 33576677 missense probably benign 0.05
X0020:Tex15 UTSW 8 33576579 missense probably benign 0.03
X0065:Tex15 UTSW 8 33575517 nonsense probably null
Z1088:Tex15 UTSW 8 33571315 missense possibly damaging 0.89
Z1088:Tex15 UTSW 8 33571810 missense possibly damaging 0.68
Z1088:Tex15 UTSW 8 33574870 missense probably benign
Z1176:Tex15 UTSW 8 33574726 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TCAGCCTTCTAACAGTATCAGAAGTG -3'
(R):5'- GTCACAAGTTACTAAAGGACAGTC -3'

Sequencing Primer
(F):5'- TCTGGTAAAATGAGAAATGTCAGTC -3'
(R):5'- AGTCTTTCTTATCATTTGTTTCAGCC -3'
Posted On2019-12-03