Incidental Mutation 'R7816:Vmn2r103'
ID601573
Institutional Source Beutler Lab
Gene Symbol Vmn2r103
Ensembl Gene ENSMUSG00000091771
Gene Namevomeronasal 2, receptor 103
SynonymsEG627636
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R7816 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location19773363-19812536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19794214 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 423 (Y423N)
Ref Sequence ENSEMBL: ENSMUSP00000126756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172203]
Predicted Effect probably benign
Transcript: ENSMUST00000172203
AA Change: Y423N

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000126756
Gene: ENSMUSG00000091771
AA Change: Y423N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 449 1.3e-37 PFAM
Pfam:NCD3G 509 562 3.5e-22 PFAM
Pfam:7tm_3 595 830 1.1e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,292,429 S1321P probably benign Het
Abcb1a T C 5: 8,686,132 V175A possibly damaging Het
Adamts20 T A 15: 94,322,844 M1403L probably benign Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Amotl2 T A 9: 102,731,654 I789K probably benign Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bcar3 C T 3: 122,426,694 T80I probably benign Het
Bcas1 G T 2: 170,406,427 F181L probably benign Het
Cacnb1 T C 11: 98,005,289 E389G probably damaging Het
Cd52 A T 4: 134,093,888 probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Coro2a T C 4: 46,546,809 D182G probably benign Het
Crp T C 1: 172,698,710 S121P possibly damaging Het
Csnka2ip T C 16: 64,479,489 probably benign Het
Cttnbp2 T C 6: 18,448,414 D82G probably damaging Het
Cyp2b9 A G 7: 26,201,092 N385S probably benign Het
Dppa1 A G 11: 46,616,176 S26P possibly damaging Het
Eif4e3 T C 6: 99,640,638 R91G probably damaging Het
F13a1 A T 13: 37,025,771 N73K probably benign Het
Fbxl13 T C 5: 21,543,787 Y378C probably benign Het
Glis2 G A 16: 4,613,464 R285H probably damaging Het
Gm13089 G T 4: 143,698,194 N226K probably benign Het
Gm17174 T A 14: 51,592,112 probably benign Het
Gm5771 T C 6: 41,394,773 L51P probably damaging Het
Golga1 G A 2: 39,052,098 S102F probably damaging Het
Hdac1 A T 4: 129,518,095 Y336N probably damaging Het
Hfe G T 13: 23,704,399 T168K possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ighv1-56 T C 12: 115,243,226 S4G probably benign Het
Ino80d A G 1: 63,086,397 Y74H probably damaging Het
Ints1 A T 5: 139,771,379 H427Q possibly damaging Het
Itpkb T A 1: 180,413,889 V708E probably damaging Het
Jmjd4 G T 11: 59,450,336 G31V probably benign Het
Kcnh5 C T 12: 74,976,683 C537Y probably damaging Het
Kcnj11 A T 7: 46,099,857 L14Q probably damaging Het
Lipo4 A T 19: 33,514,242 W114R probably damaging Het
Lrrc9 T A 12: 72,495,692 I1096N probably damaging Het
Lyzl6 C T 11: 103,636,854 V15I probably benign Het
Map4k4 A G 1: 40,014,208 T856A possibly damaging Het
Mks1 T A 11: 87,860,716 W346R probably damaging Het
Mtmr14 T C 6: 113,266,302 Y32H probably damaging Het
Muc13 A G 16: 33,799,016 S45G unknown Het
Mx2 G A 16: 97,545,612 G93D probably damaging Het
Noc4l A T 5: 110,649,673 V365E probably benign Het
Odf2l T C 3: 145,151,015 I577T probably damaging Het
Olfr723 T C 14: 49,929,165 I126M probably damaging Het
Peg10 C CTCT 6: 4,756,453 probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Pnoc A T 14: 65,401,858 I186N possibly damaging Het
Pou4f3 A G 18: 42,395,186 I65V probably benign Het
Ptpn21 G A 12: 98,682,532 A955V probably damaging Het
Rabgap1 G T 2: 37,563,464 R968L probably benign Het
Rarres1 T C 3: 67,479,344 N282S probably damaging Het
Rgs17 T C 10: 5,841,501 N72S probably benign Het
Rp1 T A 1: 4,347,703 N1062I probably damaging Het
Rpn1 T A 6: 88,103,396 V559D possibly damaging Het
Rrbp1 A T 2: 143,988,935 N437K probably damaging Het
Rtn4r C A 16: 18,151,535 Q276K probably benign Het
Rwdd4a T C 8: 47,537,300 S16P probably damaging Het
S1pr1 A G 3: 115,712,298 S216P possibly damaging Het
Scn8a C A 15: 101,011,036 T795K possibly damaging Het
Spryd3 A C 15: 102,117,706 F401C probably damaging Het
Stk36 G T 1: 74,611,169 E287* probably null Het
Tbc1d1 G T 5: 64,349,752 S1104I probably damaging Het
Tex15 A G 8: 33,581,655 D2410G probably benign Het
Tmem92 T A 11: 94,778,958 I116F possibly damaging Het
Trp53bp2 A G 1: 182,448,695 E747G probably damaging Het
Trp63 A T 16: 25,889,240 D562V probably damaging Het
Ttc21b A G 2: 66,247,361 Y167H possibly damaging Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Uggt1 G A 1: 36,163,315 S1067F possibly damaging Het
Vmn2r111 A G 17: 22,573,102 Y58H probably damaging Het
Ypel3 T A 7: 126,777,841 V2E probably damaging Het
Ythdf3 T C 3: 16,189,517 V34A probably damaging Het
Zfp180 A T 7: 24,105,145 S330C probably damaging Het
Zfp292 G A 4: 34,809,865 P1060S probably benign Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp981 C T 4: 146,537,643 R342C probably benign Het
Other mutations in Vmn2r103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Vmn2r103 APN 17 19793102 missense probably damaging 0.98
IGL00939:Vmn2r103 APN 17 19794965 missense probably benign 0.00
IGL01120:Vmn2r103 APN 17 19792997 missense probably benign 0.06
IGL01403:Vmn2r103 APN 17 19792967 missense probably benign
IGL01404:Vmn2r103 APN 17 19812434 missense probably damaging 1.00
IGL01713:Vmn2r103 APN 17 19794068 missense probably damaging 1.00
IGL01802:Vmn2r103 APN 17 19799208 missense probably benign
IGL02251:Vmn2r103 APN 17 19793969 missense possibly damaging 0.84
IGL02466:Vmn2r103 APN 17 19773369 missense probably benign
IGL02555:Vmn2r103 APN 17 19811611 missense probably damaging 1.00
IGL02668:Vmn2r103 APN 17 19794127 missense probably benign 0.03
IGL02715:Vmn2r103 APN 17 19793956 missense probably damaging 0.97
IGL02735:Vmn2r103 APN 17 19812248 missense probably benign 0.27
IGL03101:Vmn2r103 APN 17 19773520 missense probably damaging 0.98
R0003:Vmn2r103 UTSW 17 19811979 missense probably damaging 0.99
R0052:Vmn2r103 UTSW 17 19811641 missense probably benign 0.01
R0375:Vmn2r103 UTSW 17 19792859 missense probably benign 0.06
R0375:Vmn2r103 UTSW 17 19793464 missense probably benign 0.12
R0755:Vmn2r103 UTSW 17 19773568 missense probably benign 0.01
R0837:Vmn2r103 UTSW 17 19793927 missense probably damaging 0.99
R1345:Vmn2r103 UTSW 17 19794247 missense probably damaging 1.00
R1396:Vmn2r103 UTSW 17 19792968 missense probably benign
R1488:Vmn2r103 UTSW 17 19793660 missense probably damaging 0.97
R1533:Vmn2r103 UTSW 17 19773400 missense probably benign 0.01
R1590:Vmn2r103 UTSW 17 19794234 missense probably benign
R1928:Vmn2r103 UTSW 17 19811767 missense possibly damaging 0.95
R1942:Vmn2r103 UTSW 17 19812300 missense probably benign 0.02
R2071:Vmn2r103 UTSW 17 19793794 missense probably benign
R2219:Vmn2r103 UTSW 17 19793647 missense probably damaging 1.00
R2442:Vmn2r103 UTSW 17 19773531 missense probably benign 0.00
R2889:Vmn2r103 UTSW 17 19793600 missense probably damaging 1.00
R3762:Vmn2r103 UTSW 17 19812149 missense probably damaging 0.98
R4014:Vmn2r103 UTSW 17 19793604 missense possibly damaging 0.67
R4331:Vmn2r103 UTSW 17 19794233 missense probably benign 0.00
R4630:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4631:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4632:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4660:Vmn2r103 UTSW 17 19811815 missense probably damaging 1.00
R4801:Vmn2r103 UTSW 17 19795076 missense probably benign 0.06
R4802:Vmn2r103 UTSW 17 19795076 missense probably benign 0.06
R4931:Vmn2r103 UTSW 17 19811769 missense probably benign 0.01
R4995:Vmn2r103 UTSW 17 19773511 missense probably benign 0.14
R5309:Vmn2r103 UTSW 17 19793034 missense probably benign 0.01
R5312:Vmn2r103 UTSW 17 19793034 missense probably benign 0.01
R5329:Vmn2r103 UTSW 17 19812171 missense probably damaging 1.00
R5611:Vmn2r103 UTSW 17 19793642 missense probably damaging 0.99
R5684:Vmn2r103 UTSW 17 19792989 missense probably benign 0.02
R5715:Vmn2r103 UTSW 17 19794939 missense probably benign 0.17
R5907:Vmn2r103 UTSW 17 19812453 missense possibly damaging 0.67
R6029:Vmn2r103 UTSW 17 19794216 nonsense probably null
R6114:Vmn2r103 UTSW 17 19812325 missense probably damaging 0.99
R6285:Vmn2r103 UTSW 17 19812144 missense probably benign
R6292:Vmn2r103 UTSW 17 19793604 missense possibly damaging 0.67
R6334:Vmn2r103 UTSW 17 19794082 missense probably damaging 0.97
R6501:Vmn2r103 UTSW 17 19811904 missense probably benign 0.29
R6710:Vmn2r103 UTSW 17 19811977 missense probably damaging 1.00
R6774:Vmn2r103 UTSW 17 19773511 missense probably benign 0.14
R6981:Vmn2r103 UTSW 17 19793477 missense probably benign 0.00
R7768:Vmn2r103 UTSW 17 19812052 missense probably damaging 0.99
R7885:Vmn2r103 UTSW 17 19793123 missense probably benign 0.25
R7968:Vmn2r103 UTSW 17 19793123 missense probably benign 0.25
R8002:Vmn2r103 UTSW 17 19799249 missense not run
R8031:Vmn2r103 UTSW 17 19793497 missense not run
Z1088:Vmn2r103 UTSW 17 19795047 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTCAAGTGCTCATTTGCTGAC -3'
(R):5'- CACACGATTTCAGAACATCATTCACTG -3'

Sequencing Primer
(F):5'- GTGCTCATTTGCTGACATTAATTG -3'
(R):5'- CAGAACATCATTCACTGGAATTGAC -3'
Posted On2019-12-03