Incidental Mutation 'R7816:Vmn2r103'
ID 601573
Institutional Source Beutler Lab
Gene Symbol Vmn2r103
Ensembl Gene ENSMUSG00000091771
Gene Name vomeronasal 2, receptor 103
Synonyms EG627636
MMRRC Submission 045870-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R7816 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 19993625-20032798 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20014476 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 423 (Y423N)
Ref Sequence ENSEMBL: ENSMUSP00000126756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172203]
AlphaFold E9PWW0
Predicted Effect probably benign
Transcript: ENSMUST00000172203
AA Change: Y423N

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000126756
Gene: ENSMUSG00000091771
AA Change: Y423N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 449 1.3e-37 PFAM
Pfam:NCD3G 509 562 3.5e-22 PFAM
Pfam:7tm_3 595 830 1.1e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,331,588 (GRCm39) S1321P probably benign Het
Abcb1a T C 5: 8,736,132 (GRCm39) V175A possibly damaging Het
Adamts20 T A 15: 94,220,725 (GRCm39) M1403L probably benign Het
Akap13 G A 7: 75,380,213 (GRCm39) R462H probably damaging Het
Amotl2 T A 9: 102,608,853 (GRCm39) I789K probably benign Het
BC005537 C T 13: 24,987,382 (GRCm39) R7W possibly damaging Het
Bcar3 C T 3: 122,220,343 (GRCm39) T80I probably benign Het
Bcas1 G T 2: 170,248,347 (GRCm39) F181L probably benign Het
Cacnb1 T C 11: 97,896,115 (GRCm39) E389G probably damaging Het
Cd52 A T 4: 133,821,199 (GRCm39) probably benign Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 105,036,102 (GRCm39) probably benign Het
Coro2a T C 4: 46,546,809 (GRCm39) D182G probably benign Het
Crp T C 1: 172,526,277 (GRCm39) S121P possibly damaging Het
Csnka2ip T C 16: 64,299,852 (GRCm39) probably benign Het
Cttnbp2 T C 6: 18,448,413 (GRCm39) D82G probably damaging Het
Cyp2b9 A G 7: 25,900,517 (GRCm39) N385S probably benign Het
Dppa1 A G 11: 46,507,003 (GRCm39) S26P possibly damaging Het
Eif4e3 T C 6: 99,617,599 (GRCm39) R91G probably damaging Het
F13a1 A T 13: 37,209,745 (GRCm39) N73K probably benign Het
Fbxl13 T C 5: 21,748,785 (GRCm39) Y378C probably benign Het
Glis2 G A 16: 4,431,328 (GRCm39) R285H probably damaging Het
Gm17174 T A 14: 51,829,569 (GRCm39) probably benign Het
Golga1 G A 2: 38,942,110 (GRCm39) S102F probably damaging Het
Hdac1 A T 4: 129,411,888 (GRCm39) Y336N probably damaging Het
Hfe G T 13: 23,888,382 (GRCm39) T168K possibly damaging Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Ighv1-56 T C 12: 115,206,846 (GRCm39) S4G probably benign Het
Ino80d A G 1: 63,125,556 (GRCm39) Y74H probably damaging Het
Ints1 A T 5: 139,757,134 (GRCm39) H427Q possibly damaging Het
Itpkb T A 1: 180,241,454 (GRCm39) V708E probably damaging Het
Jmjd4 G T 11: 59,341,162 (GRCm39) G31V probably benign Het
Kcnh5 C T 12: 75,023,457 (GRCm39) C537Y probably damaging Het
Kcnj11 A T 7: 45,749,281 (GRCm39) L14Q probably damaging Het
Lipo4 A T 19: 33,491,642 (GRCm39) W114R probably damaging Het
Lrrc9 T A 12: 72,542,466 (GRCm39) I1096N probably damaging Het
Lyzl6 C T 11: 103,527,680 (GRCm39) V15I probably benign Het
Map4k4 A G 1: 40,053,368 (GRCm39) T856A possibly damaging Het
Mks1 T A 11: 87,751,542 (GRCm39) W346R probably damaging Het
Mtmr14 T C 6: 113,243,263 (GRCm39) Y32H probably damaging Het
Muc13 A G 16: 33,619,386 (GRCm39) S45G unknown Het
Mx2 G A 16: 97,346,812 (GRCm39) G93D probably damaging Het
Noc4l A T 5: 110,797,539 (GRCm39) V365E probably benign Het
Odf2l T C 3: 144,856,776 (GRCm39) I577T probably damaging Het
Or4l1 T C 14: 50,166,622 (GRCm39) I126M probably damaging Het
Peg10 C CTCT 6: 4,756,453 (GRCm39) probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Pnoc A T 14: 65,639,307 (GRCm39) I186N possibly damaging Het
Pou4f3 A G 18: 42,528,251 (GRCm39) I65V probably benign Het
Pramel23 G T 4: 143,424,764 (GRCm39) N226K probably benign Het
Prss1l T C 6: 41,371,707 (GRCm39) L51P probably damaging Het
Ptpn21 G A 12: 98,648,791 (GRCm39) A955V probably damaging Het
Rabgap1 G T 2: 37,453,476 (GRCm39) R968L probably benign Het
Rarres1 T C 3: 67,386,677 (GRCm39) N282S probably damaging Het
Rgs17 T C 10: 5,791,501 (GRCm39) N72S probably benign Het
Rp1 T A 1: 4,417,926 (GRCm39) N1062I probably damaging Het
Rpn1 T A 6: 88,080,378 (GRCm39) V559D possibly damaging Het
Rrbp1 A T 2: 143,830,855 (GRCm39) N437K probably damaging Het
Rtn4r C A 16: 17,969,399 (GRCm39) Q276K probably benign Het
Rwdd4a T C 8: 47,990,335 (GRCm39) S16P probably damaging Het
S1pr1 A G 3: 115,505,947 (GRCm39) S216P possibly damaging Het
Scn8a C A 15: 100,908,917 (GRCm39) T795K possibly damaging Het
Spryd3 A C 15: 102,026,141 (GRCm39) F401C probably damaging Het
Stk36 G T 1: 74,650,328 (GRCm39) E287* probably null Het
Tbc1d1 G T 5: 64,507,095 (GRCm39) S1104I probably damaging Het
Tex15 A G 8: 34,071,683 (GRCm39) D2410G probably benign Het
Tmem92 T A 11: 94,669,784 (GRCm39) I116F possibly damaging Het
Trp53bp2 A G 1: 182,276,260 (GRCm39) E747G probably damaging Het
Trp63 A T 16: 25,707,990 (GRCm39) D562V probably damaging Het
Ttc21b A G 2: 66,077,705 (GRCm39) Y167H possibly damaging Het
Ubr5 G A 15: 37,980,076 (GRCm39) A2434V probably null Het
Uggt1 G A 1: 36,202,396 (GRCm39) S1067F possibly damaging Het
Vmn2r111 A G 17: 22,792,083 (GRCm39) Y58H probably damaging Het
Ypel3 T A 7: 126,377,013 (GRCm39) V2E probably damaging Het
Ythdf3 T C 3: 16,243,681 (GRCm39) V34A probably damaging Het
Zfp180 A T 7: 23,804,570 (GRCm39) S330C probably damaging Het
Zfp292 G A 4: 34,809,865 (GRCm39) P1060S probably benign Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,706,067 (GRCm39) probably benign Het
Zfp981 C T 4: 146,622,100 (GRCm39) R342C probably benign Het
Other mutations in Vmn2r103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Vmn2r103 APN 17 20,013,364 (GRCm39) missense probably damaging 0.98
IGL00939:Vmn2r103 APN 17 20,015,227 (GRCm39) missense probably benign 0.00
IGL01120:Vmn2r103 APN 17 20,013,259 (GRCm39) missense probably benign 0.06
IGL01403:Vmn2r103 APN 17 20,013,229 (GRCm39) missense probably benign
IGL01404:Vmn2r103 APN 17 20,032,696 (GRCm39) missense probably damaging 1.00
IGL01713:Vmn2r103 APN 17 20,014,330 (GRCm39) missense probably damaging 1.00
IGL01802:Vmn2r103 APN 17 20,019,470 (GRCm39) missense probably benign
IGL02251:Vmn2r103 APN 17 20,014,231 (GRCm39) missense possibly damaging 0.84
IGL02466:Vmn2r103 APN 17 19,993,631 (GRCm39) missense probably benign
IGL02555:Vmn2r103 APN 17 20,031,873 (GRCm39) missense probably damaging 1.00
IGL02668:Vmn2r103 APN 17 20,014,389 (GRCm39) missense probably benign 0.03
IGL02715:Vmn2r103 APN 17 20,014,218 (GRCm39) missense probably damaging 0.97
IGL02735:Vmn2r103 APN 17 20,032,510 (GRCm39) missense probably benign 0.27
IGL03101:Vmn2r103 APN 17 19,993,782 (GRCm39) missense probably damaging 0.98
R0003:Vmn2r103 UTSW 17 20,032,241 (GRCm39) missense probably damaging 0.99
R0052:Vmn2r103 UTSW 17 20,031,903 (GRCm39) missense probably benign 0.01
R0375:Vmn2r103 UTSW 17 20,013,726 (GRCm39) missense probably benign 0.12
R0375:Vmn2r103 UTSW 17 20,013,121 (GRCm39) missense probably benign 0.06
R0755:Vmn2r103 UTSW 17 19,993,830 (GRCm39) missense probably benign 0.01
R0837:Vmn2r103 UTSW 17 20,014,189 (GRCm39) missense probably damaging 0.99
R1345:Vmn2r103 UTSW 17 20,014,509 (GRCm39) missense probably damaging 1.00
R1396:Vmn2r103 UTSW 17 20,013,230 (GRCm39) missense probably benign
R1488:Vmn2r103 UTSW 17 20,013,922 (GRCm39) missense probably damaging 0.97
R1533:Vmn2r103 UTSW 17 19,993,662 (GRCm39) missense probably benign 0.01
R1590:Vmn2r103 UTSW 17 20,014,496 (GRCm39) missense probably benign
R1928:Vmn2r103 UTSW 17 20,032,029 (GRCm39) missense possibly damaging 0.95
R1942:Vmn2r103 UTSW 17 20,032,562 (GRCm39) missense probably benign 0.02
R2071:Vmn2r103 UTSW 17 20,014,056 (GRCm39) missense probably benign
R2219:Vmn2r103 UTSW 17 20,013,909 (GRCm39) missense probably damaging 1.00
R2442:Vmn2r103 UTSW 17 19,993,793 (GRCm39) missense probably benign 0.00
R2889:Vmn2r103 UTSW 17 20,013,862 (GRCm39) missense probably damaging 1.00
R3762:Vmn2r103 UTSW 17 20,032,411 (GRCm39) missense probably damaging 0.98
R4014:Vmn2r103 UTSW 17 20,013,866 (GRCm39) missense possibly damaging 0.67
R4331:Vmn2r103 UTSW 17 20,014,495 (GRCm39) missense probably benign 0.00
R4630:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4631:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4632:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4660:Vmn2r103 UTSW 17 20,032,077 (GRCm39) missense probably damaging 1.00
R4801:Vmn2r103 UTSW 17 20,015,338 (GRCm39) missense probably benign 0.06
R4802:Vmn2r103 UTSW 17 20,015,338 (GRCm39) missense probably benign 0.06
R4931:Vmn2r103 UTSW 17 20,032,031 (GRCm39) missense probably benign 0.01
R4995:Vmn2r103 UTSW 17 19,993,773 (GRCm39) missense probably benign 0.14
R5309:Vmn2r103 UTSW 17 20,013,296 (GRCm39) missense probably benign 0.01
R5312:Vmn2r103 UTSW 17 20,013,296 (GRCm39) missense probably benign 0.01
R5329:Vmn2r103 UTSW 17 20,032,433 (GRCm39) missense probably damaging 1.00
R5611:Vmn2r103 UTSW 17 20,013,904 (GRCm39) missense probably damaging 0.99
R5684:Vmn2r103 UTSW 17 20,013,251 (GRCm39) missense probably benign 0.02
R5715:Vmn2r103 UTSW 17 20,015,201 (GRCm39) missense probably benign 0.17
R5907:Vmn2r103 UTSW 17 20,032,715 (GRCm39) missense possibly damaging 0.67
R6029:Vmn2r103 UTSW 17 20,014,478 (GRCm39) nonsense probably null
R6114:Vmn2r103 UTSW 17 20,032,587 (GRCm39) missense probably damaging 0.99
R6285:Vmn2r103 UTSW 17 20,032,406 (GRCm39) missense probably benign
R6292:Vmn2r103 UTSW 17 20,013,866 (GRCm39) missense possibly damaging 0.67
R6334:Vmn2r103 UTSW 17 20,014,344 (GRCm39) missense probably damaging 0.97
R6501:Vmn2r103 UTSW 17 20,032,166 (GRCm39) missense probably benign 0.29
R6710:Vmn2r103 UTSW 17 20,032,239 (GRCm39) missense probably damaging 1.00
R6774:Vmn2r103 UTSW 17 19,993,773 (GRCm39) missense probably benign 0.14
R6981:Vmn2r103 UTSW 17 20,013,739 (GRCm39) missense probably benign 0.00
R7768:Vmn2r103 UTSW 17 20,032,314 (GRCm39) missense probably damaging 0.99
R7885:Vmn2r103 UTSW 17 20,013,385 (GRCm39) missense probably benign 0.25
R8002:Vmn2r103 UTSW 17 20,019,511 (GRCm39) missense probably damaging 1.00
R8031:Vmn2r103 UTSW 17 20,013,759 (GRCm39) missense probably benign 0.00
R8140:Vmn2r103 UTSW 17 20,032,058 (GRCm39) missense probably damaging 1.00
R8186:Vmn2r103 UTSW 17 20,032,205 (GRCm39) missense probably damaging 1.00
R8559:Vmn2r103 UTSW 17 20,032,646 (GRCm39) missense probably benign 0.01
R9413:Vmn2r103 UTSW 17 20,032,158 (GRCm39) missense possibly damaging 0.54
R9591:Vmn2r103 UTSW 17 20,031,921 (GRCm39) missense possibly damaging 0.70
R9652:Vmn2r103 UTSW 17 20,014,027 (GRCm39) missense probably benign 0.01
R9680:Vmn2r103 UTSW 17 20,019,525 (GRCm39) nonsense probably null
R9743:Vmn2r103 UTSW 17 20,032,475 (GRCm39) missense probably damaging 1.00
Z1088:Vmn2r103 UTSW 17 20,015,309 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTCAAGTGCTCATTTGCTGAC -3'
(R):5'- CACACGATTTCAGAACATCATTCACTG -3'

Sequencing Primer
(F):5'- GTGCTCATTTGCTGACATTAATTG -3'
(R):5'- CAGAACATCATTCACTGGAATTGAC -3'
Posted On 2019-12-03