Incidental Mutation 'R7817:Tomm70a'
ID601620
Institutional Source Beutler Lab
Gene Symbol Tomm70a
Ensembl Gene ENSMUSG00000022752
Gene Nametranslocase of outer mitochondrial membrane 70A
SynonymsTomm70a, D16Wsu109e, D16Ium22e, Tom70, 2610044B22Rik, D16Ium22
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R7817 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location57121703-57156705 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 57144773 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 440 (A440V)
Ref Sequence ENSEMBL: ENSMUSP00000129186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166897]
Predicted Effect probably damaging
Transcript: ENSMUST00000166897
AA Change: A440V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129186
Gene: ENSMUSG00000022752
AA Change: A440V

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
low complexity region 45 61 N/A INTRINSIC
low complexity region 64 75 N/A INTRINSIC
low complexity region 98 108 N/A INTRINSIC
TPR 117 150 1.04e-7 SMART
TPR 156 189 1.97e-3 SMART
TPR 190 223 1.6e1 SMART
low complexity region 278 291 N/A INTRINSIC
TPR 332 365 1.17e1 SMART
TPR 370 403 3.5e0 SMART
TPR 404 437 3.32e-1 SMART
TPR 445 478 7.49e1 SMART
TPR 479 512 9.39e-1 SMART
TPR 513 547 9.48e1 SMART
TPR 548 581 4.03e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an import receptor of the outer mitochondrial membrane that is part of the translocase of the outer membrane complex. This protein is involved in the import of mitochondrial precursor proteins. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts17 T C 7: 66,909,476 V338A probably damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bivm G T 1: 44,126,401 A4S probably benign Het
Brpf1 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 6: 113,320,539 probably benign Het
Cacng3 G A 7: 122,768,599 R234Q probably damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cftr A G 6: 18,267,968 D642G probably damaging Het
Cltc A G 11: 86,725,123 V443A probably damaging Het
Csmd3 C T 15: 47,857,960 R1425H probably damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Dscam T C 16: 96,640,864 T1588A probably benign Het
Gabra4 A G 5: 71,640,863 M207T probably damaging Het
Galnt3 A G 2: 66,095,899 Y322H probably damaging Het
Glud1 A T 14: 34,329,287 probably null Het
Gm47189 A G 14: 41,770,054 Y89H probably damaging Het
Klhl1 A T 14: 96,136,750 M620K possibly damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Mocs2 A G 13: 114,820,846 E62G probably damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Nek10 C T 14: 15,001,017 P1066S probably benign Het
Nfxl1 T C 5: 72,514,289 K876E possibly damaging Het
Nipsnap3a T A 4: 52,997,279 F182I probably damaging Het
Nlrc3 C T 16: 3,965,463 G60S possibly damaging Het
Notch2 T C 3: 98,107,127 Y666H probably damaging Het
Olfr1160 T C 2: 88,006,011 I247V probably benign Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Pcdhb11 A G 18: 37,423,909 E764G probably damaging Het
Pcdhb3 T A 18: 37,302,929 D649E probably benign Het
Pde7b T G 10: 20,443,305 R90S probably damaging Het
Pik3r5 T C 11: 68,493,657 V625A probably damaging Het
Prdm9 G A 17: 15,559,049 R113W probably damaging Het
Psg26 A G 7: 18,482,647 V89A not run Het
Rad1 T C 15: 10,493,318 V277A probably benign Het
Rb1 A T 14: 73,198,543 L894Q probably damaging Het
Rorb A T 19: 18,988,096 C10S probably damaging Het
Ryk C T 9: 102,891,233 Q361* probably null Het
Serpina3b A G 12: 104,132,964 N246S probably benign Het
Srr A G 11: 74,908,698 V317A possibly damaging Het
Timd2 A T 11: 46,670,954 C288S probably benign Het
Trim62 T C 4: 128,900,685 V215A probably benign Het
Trio C G 15: 27,749,866 V2250L probably benign Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Unc13d A T 11: 116,076,283 V91D probably damaging Het
Vmn1r159 T A 7: 22,843,062 I182F possibly damaging Het
Vmn1r230 T A 17: 20,846,561 V4D probably benign Het
Zfp27 T C 7: 29,896,390 Y50C possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp518b T C 5: 38,672,398 I755V not run Het
Other mutations in Tomm70a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Tomm70a APN 16 57149810 splice site probably benign
IGL01064:Tomm70a APN 16 57152612 missense probably damaging 0.99
IGL01597:Tomm70a APN 16 57133188 missense probably benign 0.00
IGL02248:Tomm70a APN 16 57138102 missense probably benign 0.33
IGL02560:Tomm70a APN 16 57149849 missense probably benign 0.33
IGL03328:Tomm70a APN 16 57144787 missense probably damaging 0.99
IGL03335:Tomm70a APN 16 57149926 missense probably damaging 1.00
R0164:Tomm70a UTSW 16 57147821 missense probably damaging 0.96
R0164:Tomm70a UTSW 16 57147821 missense probably damaging 0.96
R0196:Tomm70a UTSW 16 57146100 missense probably benign 0.03
R0417:Tomm70a UTSW 16 57149903 missense probably benign 0.28
R0763:Tomm70a UTSW 16 57122172 missense probably benign 0.30
R1099:Tomm70a UTSW 16 57142817 missense probably damaging 1.00
R1680:Tomm70a UTSW 16 57121961 missense unknown
R2081:Tomm70a UTSW 16 57140758 missense probably damaging 0.99
R2127:Tomm70a UTSW 16 57121871 missense unknown
R3033:Tomm70a UTSW 16 57122025 missense probably damaging 1.00
R4287:Tomm70a UTSW 16 57140622 missense probably damaging 1.00
R5029:Tomm70a UTSW 16 57122151 missense probably benign
R5210:Tomm70a UTSW 16 57133251 critical splice donor site probably null
R5214:Tomm70a UTSW 16 57121937 missense unknown
R5586:Tomm70a UTSW 16 57122130 missense probably damaging 1.00
R5744:Tomm70a UTSW 16 57121839 start gained probably benign
R5872:Tomm70a UTSW 16 57144742 missense probably benign 0.06
R6256:Tomm70a UTSW 16 57152692 missense probably benign 0.05
R6699:Tomm70a UTSW 16 57142802 missense probably benign 0.02
R6902:Tomm70a UTSW 16 57138081 missense probably damaging 0.96
R7106:Tomm70a UTSW 16 57140758 missense probably damaging 0.99
R7378:Tomm70a UTSW 16 57146044 nonsense probably null
R8002:Tomm70a UTSW 16 57136734 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCTGAGCATTAACTGTGACAACAG -3'
(R):5'- GCTGTAAACCCAAGAGCTGG -3'

Sequencing Primer
(F):5'- CAACAGAAGAAAAGCATGGTATAAAC -3'
(R):5'- GTCCAAGGCCAGTTACACAGTG -3'
Posted On2019-12-03