Incidental Mutation 'R7817:Rorb'
ID601626
Institutional Source Beutler Lab
Gene Symbol Rorb
Ensembl Gene ENSMUSG00000036192
Gene NameRAR-related orphan receptor beta
SynonymsNr1f2, Rorbeta, RZR-beta
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7817 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location18930605-19111196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18988096 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 10 (C10S)
Ref Sequence ENSEMBL: ENSMUSP00000108451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040153] [ENSMUST00000112828] [ENSMUST00000112832]
Predicted Effect probably damaging
Transcript: ENSMUST00000040153
AA Change: C21S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047597
Gene: ENSMUSG00000036192
AA Change: C21S

DomainStartEndE-ValueType
ZnF_C4 18 89 1.51e-39 SMART
coiled coil region 95 133 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
HOLI 275 431 1.83e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112828
SMART Domains Protein: ENSMUSP00000108447
Gene: ENSMUSG00000036192

DomainStartEndE-ValueType
low complexity region 24 37 N/A INTRINSIC
low complexity region 49 60 N/A INTRINSIC
HOLI 190 346 1.83e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112832
AA Change: C10S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108451
Gene: ENSMUSG00000036192
AA Change: C10S

DomainStartEndE-ValueType
ZnF_C4 7 78 1.51e-39 SMART
coiled coil region 84 122 N/A INTRINSIC
low complexity region 123 134 N/A INTRINSIC
HOLI 264 420 1.83e-29 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the NR1 subfamily of nuclear hormone receptors. It is a DNA-binding protein that can bind as a monomer or as a homodimer to hormone response elements upstream of several genes to enhance the expression of those genes. The encoded protein has been shown to interact with NM23-2, a nucleoside diphosphate kinase involved in organogenesis and differentiation, and to help regulate the expression of some genes involved in circadian rhythm. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have impaired vision and a variety of behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts17 T C 7: 66,909,476 V338A probably damaging Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
BC005537 C T 13: 24,803,399 R7W possibly damaging Het
Bivm G T 1: 44,126,401 A4S probably benign Het
Brpf1 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 6: 113,320,539 probably benign Het
Cacng3 G A 7: 122,768,599 R234Q probably damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Cftr A G 6: 18,267,968 D642G probably damaging Het
Cltc A G 11: 86,725,123 V443A probably damaging Het
Csmd3 C T 15: 47,857,960 R1425H probably damaging Het
Cttnbp2 G C 6: 18,426,093 A762G possibly damaging Het
Dscam T C 16: 96,640,864 T1588A probably benign Het
Gabra4 A G 5: 71,640,863 M207T probably damaging Het
Galnt3 A G 2: 66,095,899 Y322H probably damaging Het
Glud1 A T 14: 34,329,287 probably null Het
Gm47189 A G 14: 41,770,054 Y89H probably damaging Het
Klhl1 A T 14: 96,136,750 M620K possibly damaging Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Mocs2 A G 13: 114,820,846 E62G probably damaging Het
Myh7 C G 14: 54,988,801 D461H probably damaging Het
Nek10 C T 14: 15,001,017 P1066S probably benign Het
Nfxl1 T C 5: 72,514,289 K876E possibly damaging Het
Nipsnap3a T A 4: 52,997,279 F182I probably damaging Het
Nlrc3 C T 16: 3,965,463 G60S possibly damaging Het
Notch2 T C 3: 98,107,127 Y666H probably damaging Het
Olfr1160 T C 2: 88,006,011 I247V probably benign Het
Pars2 T A 4: 106,654,079 Y353N probably damaging Het
Pcdhb11 A G 18: 37,423,909 E764G probably damaging Het
Pcdhb3 T A 18: 37,302,929 D649E probably benign Het
Pde7b T G 10: 20,443,305 R90S probably damaging Het
Pik3r5 T C 11: 68,493,657 V625A probably damaging Het
Prdm9 G A 17: 15,559,049 R113W probably damaging Het
Psg26 A G 7: 18,482,647 V89A not run Het
Rad1 T C 15: 10,493,318 V277A probably benign Het
Rb1 A T 14: 73,198,543 L894Q probably damaging Het
Ryk C T 9: 102,891,233 Q361* probably null Het
Serpina3b A G 12: 104,132,964 N246S probably benign Het
Srr A G 11: 74,908,698 V317A possibly damaging Het
Timd2 A T 11: 46,670,954 C288S probably benign Het
Tomm70a C T 16: 57,144,773 A440V probably damaging Het
Trim62 T C 4: 128,900,685 V215A probably benign Het
Trio C G 15: 27,749,866 V2250L probably benign Het
Ubr5 G A 15: 37,979,832 A2434V probably null Het
Unc13d A T 11: 116,076,283 V91D probably damaging Het
Vmn1r159 T A 7: 22,843,062 I182F possibly damaging Het
Vmn1r230 T A 17: 20,846,561 V4D probably benign Het
Zfp27 T C 7: 29,896,390 Y50C possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp518b T C 5: 38,672,398 I755V not run Het
Other mutations in Rorb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Rorb APN 19 18957328 nonsense probably null
IGL01576:Rorb APN 19 18957334 missense probably damaging 1.00
IGL02863:Rorb APN 19 18952253 missense probably benign 0.05
IGL02886:Rorb APN 19 18977579 critical splice donor site probably null
4-limb_clasper UTSW 19 18983351 missense probably damaging 1.00
dee-no UTSW 19 18955053 missense probably damaging 1.00
grasshopper UTSW 19 19110557 start codon destroyed probably null 0.45
IGL02988:Rorb UTSW 19 18937972 missense probably damaging 1.00
R0748:Rorb UTSW 19 18977800 missense probably damaging 0.97
R1087:Rorb UTSW 19 18960414 missense probably damaging 1.00
R1438:Rorb UTSW 19 18955053 missense probably damaging 1.00
R1710:Rorb UTSW 19 18960501 missense probably damaging 1.00
R1846:Rorb UTSW 19 18955081 missense probably damaging 1.00
R1852:Rorb UTSW 19 18962083 missense probably damaging 1.00
R1972:Rorb UTSW 19 18952203 missense probably damaging 0.96
R3903:Rorb UTSW 19 18962099 missense probably damaging 0.99
R3978:Rorb UTSW 19 18937890 missense probably benign 0.00
R4497:Rorb UTSW 19 18977628 missense possibly damaging 0.95
R4982:Rorb UTSW 19 18977688 missense probably benign 0.05
R5602:Rorb UTSW 19 18977937 missense probably damaging 0.97
R5733:Rorb UTSW 19 18988107 missense probably damaging 1.00
R6267:Rorb UTSW 19 18977857 missense possibly damaging 0.88
R6455:Rorb UTSW 19 18960492 missense probably damaging 1.00
R6544:Rorb UTSW 19 18952250 missense possibly damaging 0.66
R6753:Rorb UTSW 19 18957247 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGAGCTGCAGATCAGTTAGAC -3'
(R):5'- CCATTCAAATAGTAATGACCCCAGG -3'

Sequencing Primer
(F):5'- GCTGCAGATCAGTTAGACAAAAAC -3'
(R):5'- TAGTAATGACCCCAGGCCATC -3'
Posted On2019-12-03