Mutagenetix > Incidental Mutation

Incidental Mutation 'R7818:Trip12'

601628

Institutional Source

Beutler Lab

Gene Symbol

Trip12

Ensembl Gene

ENSMUSG00000026219

Gene Name

thyroid hormone receptor interactor 12

Synonyms

6720416K24Rik, 1110036I07Rik, Gtl6

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7818 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

84721189-84840516 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 84760806 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 776 (G776D)

Ref Sequence

ENSEMBL: ENSMUSP00000140267 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027421] [ENSMUST00000185909] [ENSMUST00000186465] [ENSMUST00000186648] [ENSMUST00000186894]

AlphaFold

G5E870

Predicted Effect

probably damaging
Transcript: ENSMUST00000027421
AA Change: G776D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027421
Gene: ENSMUSG00000026219
AA Change: G776D

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	765	831	7.6e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185909

SMART Domains

Protein: ENSMUSP00000139986
Gene: ENSMUSG00000026219

Domain	Start	End	E-Value	Type
low complexity region	195	214	N/A	INTRINSIC
low complexity region	219	230	N/A	INTRINSIC
low complexity region	233	257	N/A	INTRINSIC
low complexity region	273	289	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000186465
AA Change: G776D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140224
Gene: ENSMUSG00000026219
AA Change: G776D

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	5e-20	SMART
PDB:1WA5\|B	447	641	1e-5	PDB
Pfam:WWE	761	831	2.2e-22	PFAM
low complexity region	983	1006	N/A	INTRINSIC
low complexity region	1033	1047	N/A	INTRINSIC
low complexity region	1062	1073	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	1345	1362	N/A	INTRINSIC
Blast:HECTc	1363	1417	8e-8	BLAST
Blast:HECTc	1573	1629	2e-24	BLAST
HECTc	1636	2025	1.29e-177	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000186648
AA Change: G770D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139563
Gene: ENSMUSG00000026219
AA Change: G770D

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	386	400	N/A	INTRINSIC
low complexity region	410	421	N/A	INTRINSIC
SCOP:d1ee4a_	440	654	5e-20	SMART
PDB:1WA5\|B	441	635	1e-5	PDB
low complexity region	950	973	N/A	INTRINSIC
low complexity region	1000	1014	N/A	INTRINSIC
low complexity region	1029	1040	N/A	INTRINSIC
low complexity region	1300	1311	N/A	INTRINSIC
low complexity region	1312	1329	N/A	INTRINSIC
Blast:HECTc	1330	1384	7e-8	BLAST
Blast:HECTc	1540	1596	2e-24	BLAST
HECTc	1603	1992	6.2e-180	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000186894
AA Change: G776D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140267
Gene: ENSMUSG00000026219
AA Change: G776D

Domain	Start	End	E-Value	Type
low complexity region	34	39	N/A	INTRINSIC
low complexity region	153	172	N/A	INTRINSIC
low complexity region	177	188	N/A	INTRINSIC
low complexity region	191	215	N/A	INTRINSIC
low complexity region	231	247	N/A	INTRINSIC
low complexity region	379	391	N/A	INTRINSIC
low complexity region	392	406	N/A	INTRINSIC
low complexity region	416	427	N/A	INTRINSIC
SCOP:d1ee4a_	446	660	3e-20	SMART
PDB:1WA5\|B	447	641	7e-6	PDB
Blast:ARM	476	516	6e-6	BLAST
WWE	764	839	6.9e-25	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

99% (88/89)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase involved in the degradation of the p19ARF/ARF isoform of CDKN2A, a tumor suppressor. The encoded protein also plays a role in the DNA damage response by regulating the stability of USP7, which regulates tumor suppressor p53. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit complete embryonic lethality during organogenesis associated with embryonic growth retardation and abnormal placenta development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 88 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931429L15Rik	T	A	9: 46,304,221	R342S	probably benign	Het
Aatk	C	T	11: 120,021,455	V55I	probably benign	Het
Abhd10	T	A	16: 45,737,553	I128L	probably benign	Het
Abraxas1	T	A	5: 100,806,310	M325L	probably benign	Het
Adgrb2	C	A	4: 130,014,560	L1087I	probably damaging	Het
Adgrb2	C	T	4: 130,014,969	P1124S	possibly damaging	Het
Akap9	T	A	5: 4,013,875	Y1741*	probably null	Het
Ap1g2	A	T	14: 55,099,724	V718D	probably benign	Het
Asph	A	T	4: 9,475,015	M637K	probably damaging	Het
Atp2c1	T	C	9: 105,414,757	I869V	probably benign	Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
Cacna1e	T	C	1: 154,398,406	D2251G	probably damaging	Het
Camk2b	A	G	11: 5,977,812	S413P	probably benign	Het
Casz1	G	A	4: 148,946,076	C1184Y	probably damaging	Het
Cbr4	G	A	8: 61,487,942	V32I	probably benign	Het
Ccdc166	A	G	15: 75,981,015	S368P	possibly damaging	Het
Ccdc170	A	G	10: 4,549,603	N508S	probably benign	Het
Ccdc187	A	G	2: 26,276,174	S748P	possibly damaging	Het
Cdca8	A	T	4: 124,926,663		probably null	Het
Cep120	T	C	18: 53,723,103	D414G	probably benign	Het
Dcp1a	G	T	14: 30,479,721	A34S	probably damaging	Het
Ddit3	C	T	10: 127,295,793	T70I	probably benign	Het
Dlg2	C	G	7: 91,940,017	A313G	probably damaging	Het
Dnah9	A	T	11: 66,025,211	V2305D	possibly damaging	Het
Dock1	T	A	7: 134,763,865	D427E	probably damaging	Het
Dolpp1	T	C	2: 30,396,491	L141P	probably benign	Het
Dsc2	A	T	18: 20,050,132	D76E	probably damaging	Het
Dusp7	C	A	9: 106,369,130	N111K	probably benign	Het
Fam193a	A	G	5: 34,465,653	E1195G	possibly damaging	Het
Fig4	A	G	10: 41,263,166	L347P	probably damaging	Het
Frem1	T	C	4: 83,014,008	E152G	probably damaging	Het
Galnt2	G	T	8: 124,329,788	D234Y	probably damaging	Het
Hist1h1d	C	T	13: 23,554,991		probably benign	Het
Igkv4-59	T	C	6: 69,438,491	T27A	possibly damaging	Het
Ihh	T	C	1: 74,946,645	D227G	possibly damaging	Het
Il1rap	T	A	16: 26,698,847	C266S	probably damaging	Het
Iqcf4	A	T	9: 106,570,539	L57*	probably null	Het
Kif2b	A	G	11: 91,576,126	S444P	probably damaging	Het
Lmf1	T	G	17: 25,662,591	I538S	probably benign	Het
Mical2	A	G	7: 112,345,307	Y948C	probably damaging	Het
Mr1	G	A	1: 155,130,636	Q322*	probably null	Het
Mroh2a	T	C	1: 88,234,612		probably null	Het
Mup6	A	G	4: 60,004,884	T100A	probably benign	Het
Mybpc1	T	A	10: 88,558,667	D266V	probably damaging	Het
Myocos	T	C	1: 162,647,494	N48S	unknown	Het
Naf1	G	A	8: 66,889,376	G551E	probably damaging	Het
Nrarp	A	G	2: 25,181,238	N43S	possibly damaging	Het
Olfr1253	A	G	2: 89,751,944	S295P	possibly damaging	Het
Olfr19	A	C	16: 16,673,573	M136R	probably damaging	Het
Olfr472	G	A	7: 107,903,023	C102Y	probably benign	Het
Olfr832	T	A	9: 18,945,009	Y120*	probably null	Het
Olfr983	T	A	9: 40,092,712	M85L	probably damaging	Het
Padi3	T	A	4: 140,798,142	T177S	possibly damaging	Het
Pde3b	A	G	7: 114,491,440	M305V	probably damaging	Het
Pde6a	T	A	18: 61,281,509		probably null	Het
Plscr4	C	T	9: 92,490,790	R322*	probably null	Het
Prph	A	G	15: 99,057,872	T446A	probably damaging	Het
Pwwp2b	T	C	7: 139,255,324	V227A	probably benign	Het
Rev3l	T	C	10: 39,823,902	I1465T	possibly damaging	Het
Rin1	A	G	19: 5,052,191	S243G	probably benign	Het
Ripor3	A	T	2: 167,989,426	I485N	probably benign	Het
Rnpc3	G	T	3: 113,629,951	P35Q	probably damaging	Het
Sbpl	G	T	17: 23,953,262	Q228K	unknown	Het
Scn11a	A	C	9: 119,784,111	N804K	probably damaging	Het
Selenoo	A	G	15: 89,096,816	T453A	probably damaging	Het
Sez6	C	T	11: 77,976,902	P882S	probably damaging	Het
Skint5	C	T	4: 113,942,726	R82H	possibly damaging	Het
Slc18a2	A	C	19: 59,263,161	T115P	probably benign	Het
Slc1a2	A	G	2: 102,743,956	D237G	probably benign	Het
Spidr	T	C	16: 16,114,865	S184G	probably damaging	Het
Stag3	A	T	5: 138,301,443	Q872L	probably benign	Het
Suds3	T	C	5: 117,115,749		probably benign	Het
Sv2c	T	A	13: 95,986,820	K382*	probably null	Het
Taf2	T	C	15: 55,065,930	I77V	probably benign	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Tdrd3	G	T	14: 87,472,200	C100F	probably damaging	Het
Tek	T	A	4: 94,827,716	H458Q	possibly damaging	Het
Tes	C	A	6: 17,099,744	P246Q	probably damaging	Het
Tgif1	A	T	17: 70,849,608		probably null	Het
Tlr11	A	T	14: 50,361,828	N424Y	probably damaging	Het
Tmc8	A	T	11: 117,792,127	N626I	probably damaging	Het
Tmem132c	T	A	5: 127,564,088	*1108K	probably null	Het
Tnks	A	T	8: 34,873,028	Y479N	probably benign	Het
Tssk1	A	G	16: 17,894,447	E32G	probably benign	Het
Ube2o	T	C	11: 116,543,910	D575G	probably damaging	Het
Uckl1	A	T	2: 181,574,667	M16K	probably damaging	Het
Zfp948	A	T	17: 21,587,723	E392D	probably benign	Het
Zmynd8	G	A	2: 165,842,831	T167I	probably damaging	Het

Other mutations in Trip12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Trip12	APN	1	84730541	missense	probably damaging	1.00
IGL00430:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00465:Trip12	APN	1	84763861	missense	probably damaging	0.96
IGL00819:Trip12	APN	1	84754272	missense	probably damaging	1.00
IGL00900:Trip12	APN	1	84724764	missense	possibly damaging	0.56
IGL00990:Trip12	APN	1	84751884	missense	probably damaging	0.99
IGL01087:Trip12	APN	1	84757859	missense	probably damaging	0.99
IGL01400:Trip12	APN	1	84751978	missense	probably damaging	0.99
IGL01521:Trip12	APN	1	84766198	splice site	probably benign
IGL01619:Trip12	APN	1	84814910	missense	probably damaging	0.99
IGL01796:Trip12	APN	1	84728278	missense	probably benign	0.42
IGL01975:Trip12	APN	1	84814813	splice site	probably benign
IGL02190:Trip12	APN	1	84766070	missense	probably damaging	0.98
IGL02474:Trip12	APN	1	84794133	missense	probably benign
IGL02517:Trip12	APN	1	84743814	unclassified	probably benign
IGL02631:Trip12	APN	1	84766008	missense	possibly damaging	0.91
IGL02991:Trip12	APN	1	84738815	missense	probably damaging	1.00
IGL03161:Trip12	APN	1	84761132	unclassified	probably benign
IGL03388:Trip12	APN	1	84743186	missense	probably damaging	0.99
cardamom	UTSW	1	84749276	missense	probably damaging	0.99
pungent	UTSW	1	84793915	missense	possibly damaging	0.70
spices	UTSW	1	84793875	missense	probably benign	0.10
sulfuric	UTSW	1	84759050	missense	probably benign	0.19
Turmeric	UTSW	1	84754343	missense	probably benign	0.07
LCD18:Trip12	UTSW	1	84754482	unclassified	probably benign
R0090:Trip12	UTSW	1	84732136	splice site	probably benign
R0111:Trip12	UTSW	1	84759133	unclassified	probably benign
R0471:Trip12	UTSW	1	84726207	missense	probably damaging	1.00
R0486:Trip12	UTSW	1	84761084	nonsense	probably null
R0557:Trip12	UTSW	1	84724747	missense	probably damaging	1.00
R0570:Trip12	UTSW	1	84751548	missense	probably damaging	1.00
R0614:Trip12	UTSW	1	84757761	missense	probably damaging	1.00
R0627:Trip12	UTSW	1	84768597	missense	probably damaging	1.00
R0630:Trip12	UTSW	1	84793915	missense	possibly damaging	0.70
R0657:Trip12	UTSW	1	84759050	missense	probably benign	0.19
R0741:Trip12	UTSW	1	84745181	missense	probably benign	0.09
R0862:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R0864:Trip12	UTSW	1	84744009	missense	probably damaging	0.99
R1124:Trip12	UTSW	1	84737037	missense	probably damaging	1.00
R1252:Trip12	UTSW	1	84776350	nonsense	probably null
R1455:Trip12	UTSW	1	84759100	missense	probably benign	0.01
R1487:Trip12	UTSW	1	84768631	missense	probably damaging	1.00
R1702:Trip12	UTSW	1	84745063	missense	probably damaging	1.00
R1781:Trip12	UTSW	1	84730621	missense	probably benign	0.01
R1847:Trip12	UTSW	1	84749269	missense	probably damaging	1.00
R1854:Trip12	UTSW	1	84728145	missense	probably damaging	1.00
R1866:Trip12	UTSW	1	84745060	missense	probably damaging	1.00
R1926:Trip12	UTSW	1	84749291	missense	probably damaging	0.98
R1935:Trip12	UTSW	1	84794101	missense	possibly damaging	0.46
R1950:Trip12	UTSW	1	84760801	missense	probably damaging	1.00
R1994:Trip12	UTSW	1	84749172	missense	probably damaging	1.00
R2014:Trip12	UTSW	1	84760866	nonsense	probably null
R2391:Trip12	UTSW	1	84814790	frame shift	probably null
R2423:Trip12	UTSW	1	84814790	frame shift	probably null
R2433:Trip12	UTSW	1	84743823	missense	possibly damaging	0.84
R2905:Trip12	UTSW	1	84754343	missense	probably benign	0.07
R3040:Trip12	UTSW	1	84742245	missense	probably benign	0.13
R3735:Trip12	UTSW	1	84814790	frame shift	probably null
R3907:Trip12	UTSW	1	84732106	missense	possibly damaging	0.53
R4394:Trip12	UTSW	1	84725741	missense	probably damaging	1.00
R4540:Trip12	UTSW	1	84749276	missense	probably damaging	0.99
R4859:Trip12	UTSW	1	84793810	missense	probably damaging	0.99
R5240:Trip12	UTSW	1	84794133	missense	probably benign
R5278:Trip12	UTSW	1	84762147	missense	probably damaging	1.00
R5377:Trip12	UTSW	1	84757431	missense	probably damaging	1.00
R5510:Trip12	UTSW	1	84768680	missense	probably damaging	1.00
R5542:Trip12	UTSW	1	84749344	missense	probably damaging	1.00
R5550:Trip12	UTSW	1	84761099	missense	probably damaging	0.99
R5886:Trip12	UTSW	1	84730458	intron	probably benign
R5893:Trip12	UTSW	1	84759163	unclassified	probably benign
R5914:Trip12	UTSW	1	84763458	missense	probably damaging	1.00
R5925:Trip12	UTSW	1	84749253	nonsense	probably null
R5985:Trip12	UTSW	1	84725771	missense	probably damaging	0.99
R6135:Trip12	UTSW	1	84760838	missense	probably benign	0.00
R6158:Trip12	UTSW	1	84761012	missense	possibly damaging	0.84
R6419:Trip12	UTSW	1	84793870	missense	probably damaging	1.00
R6816:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7144:Trip12	UTSW	1	84793714	missense	probably damaging	0.99
R7194:Trip12	UTSW	1	84794222	missense	probably benign	0.07
R7355:Trip12	UTSW	1	84814883	missense	probably damaging	1.00
R7361:Trip12	UTSW	1	84750442	missense	probably damaging	0.98
R7588:Trip12	UTSW	1	84760883	missense	probably damaging	0.99
R7705:Trip12	UTSW	1	84777449	missense	probably damaging	1.00
R7918:Trip12	UTSW	1	84745063	missense	probably damaging	0.98
R8127:Trip12	UTSW	1	84738742	missense	probably damaging	0.99
R8221:Trip12	UTSW	1	84766050	missense	possibly damaging	0.80
R8336:Trip12	UTSW	1	84766041	missense	probably benign	0.37
R8373:Trip12	UTSW	1	84795767	missense	probably damaging	0.98
R8719:Trip12	UTSW	1	84745069	missense	probably damaging	0.98
R8771:Trip12	UTSW	1	84743297	unclassified	probably benign
R8997:Trip12	UTSW	1	84793875	missense	probably benign	0.10
R9146:Trip12	UTSW	1	84794160	missense	possibly damaging	0.89
R9236:Trip12	UTSW	1	84725829	missense	probably damaging	1.00
R9338:Trip12	UTSW	1	84749298	missense	probably damaging	0.99
R9391:Trip12	UTSW	1	84795752	missense	probably benign	0.00
R9516:Trip12	UTSW	1	84757494	missense	probably damaging	1.00
X0023:Trip12	UTSW	1	84760787	missense	probably benign	0.12
X0065:Trip12	UTSW	1	84749163	missense	probably benign	0.21
Z1088:Trip12	UTSW	1	84766168	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGACCTTCTTTCTCAGGAGAC -3'
(R):5'- CGAAGTCCTCAAGAGCTGTATG -3'

Sequencing Primer
(F):5'- GACCTTCTTTCTCAGGAGACAAAATG -3'
(R):5'- GCTGTATGAGCTGACATCTTTG -3'

Posted On

2019-12-03