Incidental Mutation 'R7818:Ripor3'
ID601638
Institutional Source Beutler Lab
Gene Symbol Ripor3
Ensembl Gene ENSMUSG00000074577
Gene NameRIPOR family member 3
Synonyms2310033K02Rik, Fam65c
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7818 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location167980164-168010618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 167989426 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 485 (I485N)
Ref Sequence ENSEMBL: ENSMUSP00000096672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099073]
Predicted Effect probably benign
Transcript: ENSMUST00000099073
AA Change: I485N

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000096672
Gene: ENSMUSG00000074577
AA Change: I485N

DomainStartEndE-ValueType
Pfam:PL48 19 363 3.5e-169 PFAM
low complexity region 414 423 N/A INTRINSIC
low complexity region 445 455 N/A INTRINSIC
low complexity region 496 513 N/A INTRINSIC
low complexity region 582 602 N/A INTRINSIC
SCOP:d1gw5a_ 794 909 6e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 99% (88/89)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik T A 9: 46,304,221 R342S probably benign Het
Aatk C T 11: 120,021,455 V55I probably benign Het
Abhd10 T A 16: 45,737,553 I128L probably benign Het
Abraxas1 T A 5: 100,806,310 M325L probably benign Het
Adgrb2 C T 4: 130,014,969 P1124S possibly damaging Het
Adgrb2 C A 4: 130,014,560 L1087I probably damaging Het
Akap9 T A 5: 4,013,875 Y1741* probably null Het
Ap1g2 A T 14: 55,099,724 V718D probably benign Het
Asph A T 4: 9,475,015 M637K probably damaging Het
Atp2c1 T C 9: 105,414,757 I869V probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cacna1e T C 1: 154,398,406 D2251G probably damaging Het
Camk2b A G 11: 5,977,812 S413P probably benign Het
Casz1 G A 4: 148,946,076 C1184Y probably damaging Het
Cbr4 G A 8: 61,487,942 V32I probably benign Het
Ccdc166 A G 15: 75,981,015 S368P possibly damaging Het
Ccdc170 A G 10: 4,549,603 N508S probably benign Het
Ccdc187 A G 2: 26,276,174 S748P possibly damaging Het
Cdca8 A T 4: 124,926,663 probably null Het
Cep120 T C 18: 53,723,103 D414G probably benign Het
Dcp1a G T 14: 30,479,721 A34S probably damaging Het
Ddit3 C T 10: 127,295,793 T70I probably benign Het
Dlg2 C G 7: 91,940,017 A313G probably damaging Het
Dnah9 A T 11: 66,025,211 V2305D possibly damaging Het
Dock1 T A 7: 134,763,865 D427E probably damaging Het
Dolpp1 T C 2: 30,396,491 L141P probably benign Het
Dsc2 A T 18: 20,050,132 D76E probably damaging Het
Dusp7 C A 9: 106,369,130 N111K probably benign Het
Fam193a A G 5: 34,465,653 E1195G possibly damaging Het
Fig4 A G 10: 41,263,166 L347P probably damaging Het
Frem1 T C 4: 83,014,008 E152G probably damaging Het
Galnt2 G T 8: 124,329,788 D234Y probably damaging Het
Hist1h1d C T 13: 23,554,991 probably benign Het
Igkv4-59 T C 6: 69,438,491 T27A possibly damaging Het
Ihh T C 1: 74,946,645 D227G possibly damaging Het
Il1rap T A 16: 26,698,847 C266S probably damaging Het
Iqcf4 A T 9: 106,570,539 L57* probably null Het
Kif2b A G 11: 91,576,126 S444P probably damaging Het
Lmf1 T G 17: 25,662,591 I538S probably benign Het
Mical2 A G 7: 112,345,307 Y948C probably damaging Het
Mr1 G A 1: 155,130,636 Q322* probably null Het
Mroh2a T C 1: 88,234,612 probably null Het
Mup6 A G 4: 60,004,884 T100A probably benign Het
Mybpc1 T A 10: 88,558,667 D266V probably damaging Het
Myocos T C 1: 162,647,494 N48S unknown Het
Naf1 G A 8: 66,889,376 G551E probably damaging Het
Nrarp A G 2: 25,181,238 N43S possibly damaging Het
Olfr1253 A G 2: 89,751,944 S295P possibly damaging Het
Olfr19 A C 16: 16,673,573 M136R probably damaging Het
Olfr472 G A 7: 107,903,023 C102Y probably benign Het
Olfr832 T A 9: 18,945,009 Y120* probably null Het
Olfr983 T A 9: 40,092,712 M85L probably damaging Het
Padi3 T A 4: 140,798,142 T177S possibly damaging Het
Pde3b A G 7: 114,491,440 M305V probably damaging Het
Pde6a T A 18: 61,281,509 probably null Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Prph A G 15: 99,057,872 T446A probably damaging Het
Pwwp2b T C 7: 139,255,324 V227A probably benign Het
Rev3l T C 10: 39,823,902 I1465T possibly damaging Het
Rin1 A G 19: 5,052,191 S243G probably benign Het
Rnpc3 G T 3: 113,629,951 P35Q probably damaging Het
Sbpl G T 17: 23,953,262 Q228K unknown Het
Scn11a A C 9: 119,784,111 N804K probably damaging Het
Selenoo A G 15: 89,096,816 T453A probably damaging Het
Sez6 C T 11: 77,976,902 P882S probably damaging Het
Skint5 C T 4: 113,942,726 R82H possibly damaging Het
Slc18a2 A C 19: 59,263,161 T115P probably benign Het
Slc1a2 A G 2: 102,743,956 D237G probably benign Het
Spidr T C 16: 16,114,865 S184G probably damaging Het
Stag3 A T 5: 138,301,443 Q872L probably benign Het
Suds3 T C 5: 117,115,749 probably benign Het
Sv2c T A 13: 95,986,820 K382* probably null Het
Taf2 T C 15: 55,065,930 I77V probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tdrd3 G T 14: 87,472,200 C100F probably damaging Het
Tek T A 4: 94,827,716 H458Q possibly damaging Het
Tes C A 6: 17,099,744 P246Q probably damaging Het
Tgif1 A T 17: 70,849,608 probably null Het
Tlr11 A T 14: 50,361,828 N424Y probably damaging Het
Tmc8 A T 11: 117,792,127 N626I probably damaging Het
Tmem132c T A 5: 127,564,088 *1108K probably null Het
Tnks A T 8: 34,873,028 Y479N probably benign Het
Trip12 C T 1: 84,760,806 G776D probably damaging Het
Tssk1 A G 16: 17,894,447 E32G probably benign Het
Ube2o T C 11: 116,543,910 D575G probably damaging Het
Uckl1 A T 2: 181,574,667 M16K probably damaging Het
Zfp948 A T 17: 21,587,723 E392D probably benign Het
Zmynd8 G A 2: 165,842,831 T167I probably damaging Het
Other mutations in Ripor3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:Ripor3 APN 2 167993575 missense probably benign 0.05
IGL01621:Ripor3 APN 2 167997252 missense probably damaging 0.97
IGL01819:Ripor3 APN 2 167980843 missense probably damaging 0.99
IGL01891:Ripor3 APN 2 167983151 missense possibly damaging 0.95
IGL02110:Ripor3 APN 2 167994706 missense possibly damaging 0.95
IGL02270:Ripor3 APN 2 167993496 missense probably damaging 0.97
IGL02403:Ripor3 APN 2 167989330 missense probably damaging 1.00
IGL02445:Ripor3 APN 2 167992762 splice site probably benign
IGL02447:Ripor3 APN 2 167992830 missense probably damaging 0.99
IGL02711:Ripor3 APN 2 168006280 utr 5 prime probably benign
IGL03187:Ripor3 APN 2 167985668 missense possibly damaging 0.64
IGL03304:Ripor3 APN 2 167980928 splice site probably benign
R0062:Ripor3 UTSW 2 167984438 splice site probably benign
R0062:Ripor3 UTSW 2 167984438 splice site probably benign
R0233:Ripor3 UTSW 2 167992598 missense probably damaging 1.00
R0233:Ripor3 UTSW 2 167992598 missense probably damaging 1.00
R0387:Ripor3 UTSW 2 167983772 nonsense probably null
R1457:Ripor3 UTSW 2 167992653 missense probably damaging 1.00
R1481:Ripor3 UTSW 2 168000377 missense possibly damaging 0.95
R1619:Ripor3 UTSW 2 167980845 missense probably damaging 0.96
R2358:Ripor3 UTSW 2 167983865 splice site probably benign
R2431:Ripor3 UTSW 2 167989795 missense probably benign 0.06
R2943:Ripor3 UTSW 2 167983761 missense possibly damaging 0.46
R3000:Ripor3 UTSW 2 167991180 missense probably damaging 1.00
R3730:Ripor3 UTSW 2 167992819 missense probably damaging 1.00
R3731:Ripor3 UTSW 2 167992819 missense probably damaging 1.00
R4084:Ripor3 UTSW 2 167984466 missense possibly damaging 0.55
R4796:Ripor3 UTSW 2 167981340 missense probably damaging 0.97
R4854:Ripor3 UTSW 2 167992813 missense probably benign 0.05
R4934:Ripor3 UTSW 2 167982816 missense probably benign
R4968:Ripor3 UTSW 2 167985117 missense probably benign 0.41
R5662:Ripor3 UTSW 2 167993556 missense probably benign 0.01
R5739:Ripor3 UTSW 2 167981283 missense probably damaging 1.00
R5888:Ripor3 UTSW 2 167997287 missense probably damaging 1.00
R6844:Ripor3 UTSW 2 167993333 splice site probably null
R6969:Ripor3 UTSW 2 167985737 missense probably benign 0.01
R6994:Ripor3 UTSW 2 167997266 missense probably damaging 0.99
R7609:Ripor3 UTSW 2 167984570 missense possibly damaging 0.86
R8329:Ripor3 UTSW 2 167983199 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- ATACCTTCAACCGCTCCCTGAG -3'
(R):5'- GATTCCTTCAGCTCTGAGGACC -3'

Sequencing Primer
(F):5'- TCCCTGAGGCCAAGGACTTG -3'
(R):5'- TGAGACCAGTACTTCGGCATC -3'
Posted On2019-12-03