Incidental Mutation 'R7818:Tnks'
ID601666
Institutional Source Beutler Lab
Gene Symbol Tnks
Ensembl Gene ENSMUSG00000031529
Gene Nametankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
SynonymsmTNKS1, 4930554K12Rik, D130072O21Rik, TANK1, tankyrase 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7818 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location34826460-34965690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34873028 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 479 (Y479N)
Ref Sequence ENSEMBL: ENSMUSP00000033929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033929]
PDB Structure Crystal structure of a mouse Tankyrase-Axin complex [X-RAY DIFFRACTION]
Co-crystal structure of tankyrase 1 with compound 3 [(4S)-3-{4-[6-amino-5-(pyrimidin-2-yl)pyridin-3-yl]phenyl}-5,5-dimethyl-4-phenyl-1,3-oxazolidin-2-one] [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000033929
AA Change: Y479N

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000033929
Gene: ENSMUSG00000031529
AA Change: Y479N

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 20 55 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
low complexity region 91 175 N/A INTRINSIC
ANK 208 237 4.26e-4 SMART
ANK 241 270 3.23e-4 SMART
ANK 274 303 3.28e-5 SMART
ANK 327 355 2.66e3 SMART
ANK 361 390 7.64e-6 SMART
ANK 394 423 2.62e-4 SMART
ANK 427 456 1.99e-4 SMART
ANK 514 546 3.18e-3 SMART
ANK 550 579 1.51e-4 SMART
ANK 583 612 4.26e-4 SMART
ANK 642 670 2.21e3 SMART
ANK 676 705 4.03e-5 SMART
ANK 709 738 2.48e-5 SMART
ANK 742 771 1.64e-5 SMART
low complexity region 792 810 N/A INTRINSIC
ANK 829 858 1.47e-7 SMART
ANK 862 891 2.21e-2 SMART
ANK 895 924 3.13e-2 SMART
low complexity region 996 1010 N/A INTRINSIC
SAM 1017 1082 1.14e-12 SMART
Pfam:PARP 1098 1303 1.5e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 99% (88/89)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele fail to exhibit any abonormalities. Male mice homozygous for a gene trapped allele exhibit decreased fat pad weight, increased metabolism, hyperinsulinemia, and hypoglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik T A 9: 46,304,221 R342S probably benign Het
Aatk C T 11: 120,021,455 V55I probably benign Het
Abhd10 T A 16: 45,737,553 I128L probably benign Het
Abraxas1 T A 5: 100,806,310 M325L probably benign Het
Adgrb2 C A 4: 130,014,560 L1087I probably damaging Het
Adgrb2 C T 4: 130,014,969 P1124S possibly damaging Het
Akap9 T A 5: 4,013,875 Y1741* probably null Het
Ap1g2 A T 14: 55,099,724 V718D probably benign Het
Asph A T 4: 9,475,015 M637K probably damaging Het
Atp2c1 T C 9: 105,414,757 I869V probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cacna1e T C 1: 154,398,406 D2251G probably damaging Het
Camk2b A G 11: 5,977,812 S413P probably benign Het
Casz1 G A 4: 148,946,076 C1184Y probably damaging Het
Cbr4 G A 8: 61,487,942 V32I probably benign Het
Ccdc166 A G 15: 75,981,015 S368P possibly damaging Het
Ccdc170 A G 10: 4,549,603 N508S probably benign Het
Ccdc187 A G 2: 26,276,174 S748P possibly damaging Het
Cdca8 A T 4: 124,926,663 probably null Het
Cep120 T C 18: 53,723,103 D414G probably benign Het
Dcp1a G T 14: 30,479,721 A34S probably damaging Het
Ddit3 C T 10: 127,295,793 T70I probably benign Het
Dlg2 C G 7: 91,940,017 A313G probably damaging Het
Dnah9 A T 11: 66,025,211 V2305D possibly damaging Het
Dock1 T A 7: 134,763,865 D427E probably damaging Het
Dolpp1 T C 2: 30,396,491 L141P probably benign Het
Dsc2 A T 18: 20,050,132 D76E probably damaging Het
Dusp7 C A 9: 106,369,130 N111K probably benign Het
Fam193a A G 5: 34,465,653 E1195G possibly damaging Het
Fig4 A G 10: 41,263,166 L347P probably damaging Het
Frem1 T C 4: 83,014,008 E152G probably damaging Het
Galnt2 G T 8: 124,329,788 D234Y probably damaging Het
Hist1h1d C T 13: 23,554,991 probably benign Het
Igkv4-59 T C 6: 69,438,491 T27A possibly damaging Het
Ihh T C 1: 74,946,645 D227G possibly damaging Het
Il1rap T A 16: 26,698,847 C266S probably damaging Het
Iqcf4 A T 9: 106,570,539 L57* probably null Het
Kif2b A G 11: 91,576,126 S444P probably damaging Het
Lmf1 T G 17: 25,662,591 I538S probably benign Het
Mical2 A G 7: 112,345,307 Y948C probably damaging Het
Mr1 G A 1: 155,130,636 Q322* probably null Het
Mroh2a T C 1: 88,234,612 probably null Het
Mup6 A G 4: 60,004,884 T100A probably benign Het
Mybpc1 T A 10: 88,558,667 D266V probably damaging Het
Myocos T C 1: 162,647,494 N48S unknown Het
Naf1 G A 8: 66,889,376 G551E probably damaging Het
Nrarp A G 2: 25,181,238 N43S possibly damaging Het
Olfr1253 A G 2: 89,751,944 S295P possibly damaging Het
Olfr19 A C 16: 16,673,573 M136R probably damaging Het
Olfr472 G A 7: 107,903,023 C102Y probably benign Het
Olfr832 T A 9: 18,945,009 Y120* probably null Het
Olfr983 T A 9: 40,092,712 M85L probably damaging Het
Padi3 T A 4: 140,798,142 T177S possibly damaging Het
Pde3b A G 7: 114,491,440 M305V probably damaging Het
Pde6a T A 18: 61,281,509 probably null Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Prph A G 15: 99,057,872 T446A probably damaging Het
Pwwp2b T C 7: 139,255,324 V227A probably benign Het
Rev3l T C 10: 39,823,902 I1465T possibly damaging Het
Rin1 A G 19: 5,052,191 S243G probably benign Het
Ripor3 A T 2: 167,989,426 I485N probably benign Het
Rnpc3 G T 3: 113,629,951 P35Q probably damaging Het
Sbpl G T 17: 23,953,262 Q228K unknown Het
Scn11a A C 9: 119,784,111 N804K probably damaging Het
Selenoo A G 15: 89,096,816 T453A probably damaging Het
Sez6 C T 11: 77,976,902 P882S probably damaging Het
Skint5 C T 4: 113,942,726 R82H possibly damaging Het
Slc18a2 A C 19: 59,263,161 T115P probably benign Het
Slc1a2 A G 2: 102,743,956 D237G probably benign Het
Spidr T C 16: 16,114,865 S184G probably damaging Het
Stag3 A T 5: 138,301,443 Q872L probably benign Het
Suds3 T C 5: 117,115,749 probably benign Het
Sv2c T A 13: 95,986,820 K382* probably null Het
Taf2 T C 15: 55,065,930 I77V probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tdrd3 G T 14: 87,472,200 C100F probably damaging Het
Tek T A 4: 94,827,716 H458Q possibly damaging Het
Tes C A 6: 17,099,744 P246Q probably damaging Het
Tgif1 A T 17: 70,849,608 probably null Het
Tlr11 A T 14: 50,361,828 N424Y probably damaging Het
Tmc8 A T 11: 117,792,127 N626I probably damaging Het
Tmem132c T A 5: 127,564,088 *1108K probably null Het
Trip12 C T 1: 84,760,806 G776D probably damaging Het
Tssk1 A G 16: 17,894,447 E32G probably benign Het
Ube2o T C 11: 116,543,910 D575G probably damaging Het
Uckl1 A T 2: 181,574,667 M16K probably damaging Het
Zfp948 A T 17: 21,587,723 E392D probably benign Het
Zmynd8 G A 2: 165,842,831 T167I probably damaging Het
Other mutations in Tnks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Tnks APN 8 34861689 splice site probably benign
IGL00901:Tnks APN 8 34838395 nonsense probably null
IGL01448:Tnks APN 8 34839982 missense probably damaging 1.00
IGL01455:Tnks APN 8 34940900 missense probably damaging 0.99
IGL01962:Tnks APN 8 34869524 missense probably damaging 1.00
IGL02088:Tnks APN 8 34839994 missense possibly damaging 0.50
IGL02260:Tnks APN 8 34842983 missense probably damaging 0.99
IGL02454:Tnks APN 8 34831728 unclassified probably benign
IGL02486:Tnks APN 8 34851198 missense probably damaging 1.00
IGL02612:Tnks APN 8 34849299 missense possibly damaging 0.48
IGL03179:Tnks APN 8 34848670 missense probably benign 0.38
IGL03404:Tnks APN 8 34940704 missense probably damaging 1.00
R0256:Tnks UTSW 8 34861547 missense probably benign 0.07
R0265:Tnks UTSW 8 34839970 nonsense probably null
R0334:Tnks UTSW 8 34853259 nonsense probably null
R0414:Tnks UTSW 8 34853309 missense probably damaging 1.00
R0526:Tnks UTSW 8 34853303 missense probably benign 0.23
R0622:Tnks UTSW 8 34940822 missense probably damaging 1.00
R1445:Tnks UTSW 8 34834603 splice site probably benign
R1618:Tnks UTSW 8 34875276 missense probably damaging 1.00
R1779:Tnks UTSW 8 34857518 missense probably benign 0.18
R1919:Tnks UTSW 8 34875232 missense probably damaging 1.00
R1938:Tnks UTSW 8 34838530 missense probably damaging 1.00
R2018:Tnks UTSW 8 34851106 missense probably damaging 1.00
R2198:Tnks UTSW 8 34848649 missense probably benign
R2198:Tnks UTSW 8 34873067 missense probably benign 0.29
R2925:Tnks UTSW 8 34965661 missense unknown
R3828:Tnks UTSW 8 34873178 missense probably damaging 1.00
R3913:Tnks UTSW 8 34873074 missense probably damaging 0.99
R3916:Tnks UTSW 8 34853361 missense probably damaging 1.00
R3917:Tnks UTSW 8 34853361 missense probably damaging 1.00
R3930:Tnks UTSW 8 34940812 missense probably damaging 1.00
R4659:Tnks UTSW 8 34849311 missense possibly damaging 0.53
R4760:Tnks UTSW 8 34851783 missense probably benign 0.38
R5091:Tnks UTSW 8 34841809 missense probably benign 0.40
R5419:Tnks UTSW 8 34965566 missense unknown
R5558:Tnks UTSW 8 34965665 start codon destroyed probably null
R5582:Tnks UTSW 8 34940861 missense probably benign 0.14
R6035:Tnks UTSW 8 34918461 missense possibly damaging 0.93
R6035:Tnks UTSW 8 34918461 missense possibly damaging 0.93
R6495:Tnks UTSW 8 34839966 critical splice donor site probably null
R6527:Tnks UTSW 8 34873093 missense probably benign 0.36
R6991:Tnks UTSW 8 34834493 missense probably damaging 1.00
R7015:Tnks UTSW 8 34838547 missense probably benign 0.04
R7038:Tnks UTSW 8 34851636 missense probably damaging 0.99
R7057:Tnks UTSW 8 34840014 missense probably damaging 1.00
R7167:Tnks UTSW 8 34849304 missense probably damaging 0.98
R7250:Tnks UTSW 8 34851758 missense probably damaging 0.98
R7475:Tnks UTSW 8 34831712 missense probably damaging 1.00
R7790:Tnks UTSW 8 34861540 missense probably benign 0.01
R7909:Tnks UTSW 8 34940704 missense probably damaging 1.00
R7970:Tnks UTSW 8 34855926 critical splice donor site probably null
R8341:Tnks UTSW 8 34873045 missense probably damaging 1.00
R8343:Tnks UTSW 8 34834584 missense probably benign 0.03
Z1177:Tnks UTSW 8 34965145 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ATGTGGTAAAGGCTCTTGTGGAAC -3'
(R):5'- GACACACTTACTCATGTCAGCC -3'

Sequencing Primer
(F):5'- CACATGAAGCAAGCATGATTAGAC -3'
(R):5'- CATGGAGCTTGTGTCAACGC -3'
Posted On2019-12-03