Incidental Mutation 'R7818:Scn11a'
ID601677
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Namesodium channel, voltage-gated, type XI, alpha
SynonymsNaN, NSS2, NaT, SNS2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R7818 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location119753759-119825456 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 119784111 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 804 (N804K)
Ref Sequence ENSEMBL: ENSMUSP00000149420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
Predicted Effect probably damaging
Transcript: ENSMUST00000070617
AA Change: N804K

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: N804K

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215718
AA Change: N804K

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik T A 9: 46,304,221 R342S probably benign Het
Aatk C T 11: 120,021,455 V55I probably benign Het
Abhd10 T A 16: 45,737,553 I128L probably benign Het
Abraxas1 T A 5: 100,806,310 M325L probably benign Het
Adgrb2 C A 4: 130,014,560 L1087I probably damaging Het
Adgrb2 C T 4: 130,014,969 P1124S possibly damaging Het
Akap9 T A 5: 4,013,875 Y1741* probably null Het
Ap1g2 A T 14: 55,099,724 V718D probably benign Het
Asph A T 4: 9,475,015 M637K probably damaging Het
Atp2c1 T C 9: 105,414,757 I869V probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cacna1e T C 1: 154,398,406 D2251G probably damaging Het
Camk2b A G 11: 5,977,812 S413P probably benign Het
Casz1 G A 4: 148,946,076 C1184Y probably damaging Het
Cbr4 G A 8: 61,487,942 V32I probably benign Het
Ccdc166 A G 15: 75,981,015 S368P possibly damaging Het
Ccdc170 A G 10: 4,549,603 N508S probably benign Het
Ccdc187 A G 2: 26,276,174 S748P possibly damaging Het
Cdca8 A T 4: 124,926,663 probably null Het
Cep120 T C 18: 53,723,103 D414G probably benign Het
Dcp1a G T 14: 30,479,721 A34S probably damaging Het
Ddit3 C T 10: 127,295,793 T70I probably benign Het
Dlg2 C G 7: 91,940,017 A313G probably damaging Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dnah9 A T 11: 66,025,211 V2305D possibly damaging Het
Dock1 T A 7: 134,763,865 D427E probably damaging Het
Dolpp1 T C 2: 30,396,491 L141P probably benign Het
Dsc2 A T 18: 20,050,132 D76E probably damaging Het
Dusp7 C A 9: 106,369,130 N111K probably benign Het
Fam193a A G 5: 34,465,653 E1195G possibly damaging Het
Fig4 A G 10: 41,263,166 L347P probably damaging Het
Frem1 T C 4: 83,014,008 E152G probably damaging Het
Galnt2 G T 8: 124,329,788 D234Y probably damaging Het
Igkv4-59 T C 6: 69,438,491 T27A possibly damaging Het
Ihh T C 1: 74,946,645 D227G possibly damaging Het
Il1rap T A 16: 26,698,847 C266S probably damaging Het
Iqcf4 A T 9: 106,570,539 L57* probably null Het
Kif2b A G 11: 91,576,126 S444P probably damaging Het
Lmf1 T G 17: 25,662,591 I538S probably benign Het
Mical2 A G 7: 112,345,307 Y948C probably damaging Het
Mr1 G A 1: 155,130,636 Q322* probably null Het
Mup6 A G 4: 60,004,884 T100A probably benign Het
Mybpc1 T A 10: 88,558,667 D266V probably damaging Het
Myocos T C 1: 162,647,494 N48S unknown Het
Naf1 G A 8: 66,889,376 G551E probably damaging Het
Nrarp A G 2: 25,181,238 N43S possibly damaging Het
Olfr1253 A G 2: 89,751,944 S295P possibly damaging Het
Olfr19 A C 16: 16,673,573 M136R probably damaging Het
Olfr472 G A 7: 107,903,023 C102Y probably benign Het
Olfr832 T A 9: 18,945,009 Y120* probably null Het
Olfr983 T A 9: 40,092,712 M85L probably damaging Het
Padi3 T A 4: 140,798,142 T177S possibly damaging Het
Pde3b A G 7: 114,491,440 M305V probably damaging Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Prph A G 15: 99,057,872 T446A probably damaging Het
Pwwp2b T C 7: 139,255,324 V227A probably benign Het
Rev3l T C 10: 39,823,902 I1465T possibly damaging Het
Rin1 A G 19: 5,052,191 S243G probably benign Het
Ripor3 A T 2: 167,989,426 I485N probably benign Het
Rnpc3 G T 3: 113,629,951 P35Q probably damaging Het
Sbpl G T 17: 23,953,262 Q228K unknown Het
Selenoo A G 15: 89,096,816 T453A probably damaging Het
Sez6 C T 11: 77,976,902 P882S probably damaging Het
Skint5 C T 4: 113,942,726 R82H possibly damaging Het
Slc18a2 A C 19: 59,263,161 T115P probably benign Het
Slc1a2 A G 2: 102,743,956 D237G probably benign Het
Spidr T C 16: 16,114,865 S184G probably damaging Het
Stag3 A T 5: 138,301,443 Q872L probably benign Het
Suds3 T C 5: 117,115,749 probably benign Het
Sv2c T A 13: 95,986,820 K382* probably null Het
Taf2 T C 15: 55,065,930 I77V probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tdrd3 G T 14: 87,472,200 C100F probably damaging Het
Tek T A 4: 94,827,716 H458Q possibly damaging Het
Tes C A 6: 17,099,744 P246Q probably damaging Het
Tlr11 A T 14: 50,361,828 N424Y probably damaging Het
Tmc8 A T 11: 117,792,127 N626I probably damaging Het
Tmem132c T A 5: 127,564,088 *1108K probably null Het
Tnks A T 8: 34,873,028 Y479N probably benign Het
Trip12 C T 1: 84,760,806 G776D probably damaging Het
Tssk1 A G 16: 17,894,447 E32G probably benign Het
Ube2o T C 11: 116,543,910 D575G probably damaging Het
Uckl1 A T 2: 181,574,667 M16K probably damaging Het
Zfp948 A T 17: 21,587,723 E392D probably benign Het
Zmynd8 G A 2: 165,842,831 T167I probably damaging Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119770506 missense probably benign 0.00
IGL00272:Scn11a APN 9 119816603 missense probably damaging 0.98
IGL00332:Scn11a APN 9 119769916 missense probably damaging 1.00
IGL00533:Scn11a APN 9 119774381 missense probably damaging 1.00
IGL00972:Scn11a APN 9 119793938 missense probably benign 0.44
IGL01338:Scn11a APN 9 119784161 splice site probably benign
IGL01534:Scn11a APN 9 119780822 missense probably benign 0.27
IGL01838:Scn11a APN 9 119758583 missense probably damaging 1.00
IGL01991:Scn11a APN 9 119819904 missense probably damaging 0.97
IGL02057:Scn11a APN 9 119765470 missense probably damaging 1.00
IGL02290:Scn11a APN 9 119774442 missense probably damaging 0.97
IGL02454:Scn11a APN 9 119758544 missense probably benign 0.00
IGL02517:Scn11a APN 9 119792398 missense probably damaging 1.00
IGL02567:Scn11a APN 9 119804489 missense probably damaging 0.99
IGL02587:Scn11a APN 9 119805684 missense probably damaging 1.00
IGL03069:Scn11a APN 9 119789963 missense probably benign 0.16
IGL03171:Scn11a APN 9 119819847 missense probably benign 0.00
Kleinie UTSW 9 119803503 missense probably benign 0.16
H8441:Scn11a UTSW 9 119807910 missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119769948 missense probably damaging 1.00
R0304:Scn11a UTSW 9 119819862 missense probably benign 0.00
R0519:Scn11a UTSW 9 119790119 missense probably damaging 1.00
R0658:Scn11a UTSW 9 119811160 missense probably benign 0.41
R0828:Scn11a UTSW 9 119755007 missense probably benign 0.00
R0893:Scn11a UTSW 9 119803330 splice site probably null
R0932:Scn11a UTSW 9 119807810 missense probably damaging 1.00
R1061:Scn11a UTSW 9 119795663 missense probably damaging 0.98
R1161:Scn11a UTSW 9 119755057 nonsense probably null
R1162:Scn11a UTSW 9 119805644 splice site probably benign
R1310:Scn11a UTSW 9 119755057 nonsense probably null
R1589:Scn11a UTSW 9 119769807 missense probably damaging 1.00
R1681:Scn11a UTSW 9 119804412 missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119755082 missense probably damaging 1.00
R1812:Scn11a UTSW 9 119780865 nonsense probably null
R1901:Scn11a UTSW 9 119779036 nonsense probably null
R1978:Scn11a UTSW 9 119780795 nonsense probably null
R1985:Scn11a UTSW 9 119754678 missense probably benign 0.19
R2022:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119792494 missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119755025 missense probably damaging 1.00
R2250:Scn11a UTSW 9 119758602 missense probably benign 0.01
R2373:Scn11a UTSW 9 119813186 missense probably benign 0.43
R2508:Scn11a UTSW 9 119765529 missense probably damaging 1.00
R3757:Scn11a UTSW 9 119803503 missense probably benign 0.16
R3767:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R3770:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R4089:Scn11a UTSW 9 119795653 splice site probably null
R4092:Scn11a UTSW 9 119789970 missense probably benign 0.03
R4247:Scn11a UTSW 9 119807886 missense probably damaging 1.00
R4279:Scn11a UTSW 9 119754362 missense probably benign 0.25
R4299:Scn11a UTSW 9 119765506 missense probably damaging 0.97
R4403:Scn11a UTSW 9 119795667 missense probably damaging 1.00
R4468:Scn11a UTSW 9 119754987 missense probably damaging 1.00
R4542:Scn11a UTSW 9 119755134 missense probably damaging 1.00
R4644:Scn11a UTSW 9 119815203 splice site probably null
R4739:Scn11a UTSW 9 119754561 missense probably benign 0.39
R4809:Scn11a UTSW 9 119819870 missense probably benign 0.00
R4954:Scn11a UTSW 9 119758659 missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119780878 missense probably benign 0.31
R5044:Scn11a UTSW 9 119819831 missense probably damaging 0.98
R5222:Scn11a UTSW 9 119815202 splice site probably null
R5224:Scn11a UTSW 9 119754792 missense probably damaging 1.00
R5400:Scn11a UTSW 9 119769908 missense probably damaging 0.97
R5555:Scn11a UTSW 9 119755238 missense probably damaging 1.00
R5711:Scn11a UTSW 9 119789924 missense probably damaging 1.00
R5950:Scn11a UTSW 9 119811124 missense probably damaging 1.00
R5984:Scn11a UTSW 9 119784016 missense probably benign
R6057:Scn11a UTSW 9 119765448 missense probably damaging 1.00
R6104:Scn11a UTSW 9 119795678 missense probably damaging 1.00
R6180:Scn11a UTSW 9 119754867 missense probably benign 0.00
R6892:Scn11a UTSW 9 119806969 missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119792426 missense probably damaging 1.00
R6949:Scn11a UTSW 9 119765514 missense probably benign 0.04
R7112:Scn11a UTSW 9 119754809 missense probably damaging 1.00
R7232:Scn11a UTSW 9 119759916 missense probably damaging 1.00
R7261:Scn11a UTSW 9 119819833 missense probably damaging 0.99
R7265:Scn11a UTSW 9 119815265 missense probably damaging 1.00
R7302:Scn11a UTSW 9 119806951 missense probably benign 0.03
R7391:Scn11a UTSW 9 119795717 missense probably damaging 1.00
R7441:Scn11a UTSW 9 119758626 missense probably benign 0.01
R7479:Scn11a UTSW 9 119759875 missense probably benign 0.38
R7608:Scn11a UTSW 9 119815313 splice site probably null
R7768:Scn11a UTSW 9 119815272 missense probably benign 0.13
R7785:Scn11a UTSW 9 119816556 missense probably benign 0.00
R7794:Scn11a UTSW 9 119765514 missense probably damaging 0.99
R7884:Scn11a UTSW 9 119804551 missense probably benign 0.01
R7967:Scn11a UTSW 9 119804551 missense probably benign 0.01
R8049:Scn11a UTSW 9 119755083 missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119755242 missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119754998 missense possibly damaging 0.94
Z1177:Scn11a UTSW 9 119819820 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCAGGACCTTGTATCCAGGG -3'
(R):5'- CTTGCCACTTCCTGTGTAGG -3'

Sequencing Primer
(F):5'- GTGTCTCTACTCTCACCAGCAAAG -3'
(R):5'- TAGGAAGGCATTGTTGGGAG -3'
Posted On2019-12-03