Incidental Mutation 'R7818:Tdrd3'
ID 601694
Institutional Source Beutler Lab
Gene Symbol Tdrd3
Ensembl Gene ENSMUSG00000022019
Gene Name tudor domain containing 3
Synonyms 4732418C03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock # R7818 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 87416639-87545504 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 87472200 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 100 (C100F)
Ref Sequence ENSEMBL: ENSMUSP00000126189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168275] [ENSMUST00000169504] [ENSMUST00000170865]
AlphaFold Q91W18
Predicted Effect probably damaging
Transcript: ENSMUST00000168275
AA Change: C106F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129019
Gene: ENSMUSG00000022019
AA Change: C106F

DomainStartEndE-ValueType
DUF1767 6 88 4.85e-24 SMART
low complexity region 269 280 N/A INTRINSIC
UBA 288 325 1.67e-7 SMART
low complexity region 338 348 N/A INTRINSIC
low complexity region 446 460 N/A INTRINSIC
TUDOR 646 705 1.07e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169504
AA Change: C106F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131542
Gene: ENSMUSG00000022019
AA Change: C106F

DomainStartEndE-ValueType
DUF1767 6 88 4.85e-24 SMART
low complexity region 269 280 N/A INTRINSIC
UBA 288 325 1.67e-7 SMART
low complexity region 338 348 N/A INTRINSIC
low complexity region 446 460 N/A INTRINSIC
TUDOR 646 705 1.07e-7 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000126212
Gene: ENSMUSG00000022019
AA Change: C94F

DomainStartEndE-ValueType
DUF1767 19 77 4.37e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170865
AA Change: C100F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126189
Gene: ENSMUSG00000022019
AA Change: C100F

DomainStartEndE-ValueType
DUF1767 3 82 1.36e-18 SMART
low complexity region 263 274 N/A INTRINSIC
UBA 282 319 1.67e-7 SMART
low complexity region 332 342 N/A INTRINSIC
low complexity region 440 454 N/A INTRINSIC
TUDOR 640 699 1.07e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 99% (88/89)
MGI Phenotype PHENOTYPE: Homozygous mice for a hypomorphic allele show increased genomic instability, and increased c-Myc/Igh translocation and R loop formation in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik T A 9: 46,304,221 R342S probably benign Het
Aatk C T 11: 120,021,455 V55I probably benign Het
Abhd10 T A 16: 45,737,553 I128L probably benign Het
Abraxas1 T A 5: 100,806,310 M325L probably benign Het
Adgrb2 C A 4: 130,014,560 L1087I probably damaging Het
Adgrb2 C T 4: 130,014,969 P1124S possibly damaging Het
Akap9 T A 5: 4,013,875 Y1741* probably null Het
Ap1g2 A T 14: 55,099,724 V718D probably benign Het
Asph A T 4: 9,475,015 M637K probably damaging Het
Atp2c1 T C 9: 105,414,757 I869V probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cacna1e T C 1: 154,398,406 D2251G probably damaging Het
Camk2b A G 11: 5,977,812 S413P probably benign Het
Casz1 G A 4: 148,946,076 C1184Y probably damaging Het
Cbr4 G A 8: 61,487,942 V32I probably benign Het
Ccdc166 A G 15: 75,981,015 S368P possibly damaging Het
Ccdc170 A G 10: 4,549,603 N508S probably benign Het
Ccdc187 A G 2: 26,276,174 S748P possibly damaging Het
Cdca8 A T 4: 124,926,663 probably null Het
Cep120 T C 18: 53,723,103 D414G probably benign Het
Dcp1a G T 14: 30,479,721 A34S probably damaging Het
Ddit3 C T 10: 127,295,793 T70I probably benign Het
Dlg2 C G 7: 91,940,017 A313G probably damaging Het
Dnah9 A T 11: 66,025,211 V2305D possibly damaging Het
Dock1 T A 7: 134,763,865 D427E probably damaging Het
Dolpp1 T C 2: 30,396,491 L141P probably benign Het
Dsc2 A T 18: 20,050,132 D76E probably damaging Het
Dusp7 C A 9: 106,369,130 N111K probably benign Het
Fam193a A G 5: 34,465,653 E1195G possibly damaging Het
Fig4 A G 10: 41,263,166 L347P probably damaging Het
Frem1 T C 4: 83,014,008 E152G probably damaging Het
Galnt2 G T 8: 124,329,788 D234Y probably damaging Het
Hist1h1d C T 13: 23,554,991 probably benign Het
Igkv4-59 T C 6: 69,438,491 T27A possibly damaging Het
Ihh T C 1: 74,946,645 D227G possibly damaging Het
Il1rap T A 16: 26,698,847 C266S probably damaging Het
Iqcf4 A T 9: 106,570,539 L57* probably null Het
Kif2b A G 11: 91,576,126 S444P probably damaging Het
Lmf1 T G 17: 25,662,591 I538S probably benign Het
Mical2 A G 7: 112,345,307 Y948C probably damaging Het
Mr1 G A 1: 155,130,636 Q322* probably null Het
Mroh2a T C 1: 88,234,612 probably null Het
Mup6 A G 4: 60,004,884 T100A probably benign Het
Mybpc1 T A 10: 88,558,667 D266V probably damaging Het
Myocos T C 1: 162,647,494 N48S unknown Het
Naf1 G A 8: 66,889,376 G551E probably damaging Het
Nrarp A G 2: 25,181,238 N43S possibly damaging Het
Olfr1253 A G 2: 89,751,944 S295P possibly damaging Het
Olfr19 A C 16: 16,673,573 M136R probably damaging Het
Olfr472 G A 7: 107,903,023 C102Y probably benign Het
Olfr832 T A 9: 18,945,009 Y120* probably null Het
Olfr983 T A 9: 40,092,712 M85L probably damaging Het
Padi3 T A 4: 140,798,142 T177S possibly damaging Het
Pde3b A G 7: 114,491,440 M305V probably damaging Het
Pde6a T A 18: 61,281,509 probably null Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Prph A G 15: 99,057,872 T446A probably damaging Het
Pwwp2b T C 7: 139,255,324 V227A probably benign Het
Rev3l T C 10: 39,823,902 I1465T possibly damaging Het
Rin1 A G 19: 5,052,191 S243G probably benign Het
Ripor3 A T 2: 167,989,426 I485N probably benign Het
Rnpc3 G T 3: 113,629,951 P35Q probably damaging Het
Sbpl G T 17: 23,953,262 Q228K unknown Het
Scn11a A C 9: 119,784,111 N804K probably damaging Het
Selenoo A G 15: 89,096,816 T453A probably damaging Het
Sez6 C T 11: 77,976,902 P882S probably damaging Het
Skint5 C T 4: 113,942,726 R82H possibly damaging Het
Slc18a2 A C 19: 59,263,161 T115P probably benign Het
Slc1a2 A G 2: 102,743,956 D237G probably benign Het
Spidr T C 16: 16,114,865 S184G probably damaging Het
Stag3 A T 5: 138,301,443 Q872L probably benign Het
Suds3 T C 5: 117,115,749 probably benign Het
Sv2c T A 13: 95,986,820 K382* probably null Het
Taf2 T C 15: 55,065,930 I77V probably benign Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tek T A 4: 94,827,716 H458Q possibly damaging Het
Tes C A 6: 17,099,744 P246Q probably damaging Het
Tgif1 A T 17: 70,849,608 probably null Het
Tlr11 A T 14: 50,361,828 N424Y probably damaging Het
Tmc8 A T 11: 117,792,127 N626I probably damaging Het
Tmem132c T A 5: 127,564,088 *1108K probably null Het
Tnks A T 8: 34,873,028 Y479N probably benign Het
Trip12 C T 1: 84,760,806 G776D probably damaging Het
Tssk1 A G 16: 17,894,447 E32G probably benign Het
Ube2o T C 11: 116,543,910 D575G probably damaging Het
Uckl1 A T 2: 181,574,667 M16K probably damaging Het
Zfp948 A T 17: 21,587,723 E392D probably benign Het
Zmynd8 G A 2: 165,842,831 T167I probably damaging Het
Other mutations in Tdrd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Tdrd3 APN 14 87472182 missense probably damaging 1.00
IGL01339:Tdrd3 APN 14 87480794 missense possibly damaging 0.75
IGL01565:Tdrd3 APN 14 87472232 missense probably benign 0.01
IGL02505:Tdrd3 APN 14 87511682 missense probably damaging 1.00
R0121:Tdrd3 UTSW 14 87539479 missense probably damaging 1.00
R0550:Tdrd3 UTSW 14 87486220 missense probably damaging 1.00
R0648:Tdrd3 UTSW 14 87472182 missense probably damaging 1.00
R1080:Tdrd3 UTSW 14 87506398 missense probably benign 0.00
R1099:Tdrd3 UTSW 14 87487239 missense probably damaging 1.00
R1126:Tdrd3 UTSW 14 87480774 missense probably damaging 1.00
R1370:Tdrd3 UTSW 14 87458054 intron probably benign
R1592:Tdrd3 UTSW 14 87505886 missense probably damaging 1.00
R1881:Tdrd3 UTSW 14 87486347 splice site probably null
R2096:Tdrd3 UTSW 14 87506352 nonsense probably null
R2162:Tdrd3 UTSW 14 87480785 missense probably damaging 0.98
R3833:Tdrd3 UTSW 14 87480785 missense probably damaging 0.98
R3947:Tdrd3 UTSW 14 87506599 missense probably damaging 1.00
R4421:Tdrd3 UTSW 14 87486283 missense probably damaging 1.00
R4783:Tdrd3 UTSW 14 87472101 missense probably damaging 1.00
R4957:Tdrd3 UTSW 14 87505787 missense probably benign 0.06
R5212:Tdrd3 UTSW 14 87506215 missense probably damaging 0.98
R5291:Tdrd3 UTSW 14 87505798 missense probably benign 0.21
R5318:Tdrd3 UTSW 14 87477463 critical splice donor site probably null
R5383:Tdrd3 UTSW 14 87480791 nonsense probably null
R5718:Tdrd3 UTSW 14 87506440 missense probably benign 0.05
R6240:Tdrd3 UTSW 14 87505886 missense probably damaging 1.00
R6292:Tdrd3 UTSW 14 87506254 missense probably benign
R6532:Tdrd3 UTSW 14 87505816 missense probably damaging 0.98
R6850:Tdrd3 UTSW 14 87458079 intron probably benign
R6958:Tdrd3 UTSW 14 87457096 missense probably damaging 1.00
R7224:Tdrd3 UTSW 14 87477403 missense probably damaging 1.00
R7240:Tdrd3 UTSW 14 87458803 missense probably benign 0.06
R7565:Tdrd3 UTSW 14 87506593 nonsense probably null
R7861:Tdrd3 UTSW 14 87472154 missense probably damaging 1.00
R8108:Tdrd3 UTSW 14 87486266 missense possibly damaging 0.95
R8206:Tdrd3 UTSW 14 87511778 missense probably benign 0.11
R8383:Tdrd3 UTSW 14 87506308 missense probably benign 0.26
R8786:Tdrd3 UTSW 14 87472201 nonsense probably null
R8985:Tdrd3 UTSW 14 87506161 missense possibly damaging 0.69
R9081:Tdrd3 UTSW 14 87506281 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGTCATTGAAAGTAGAACAGCG -3'
(R):5'- AAGGATAACTACCTTCGTCCCTAAC -3'

Sequencing Primer
(F):5'- TCATTGAAAGTAGAACAGCGGTTAAC -3'
(R):5'- GTCCCTAACTGTCTGTCAGAC -3'
Posted On 2019-12-03