Incidental Mutation 'R7818:Cep120'
ID 601709
Institutional Source Beutler Lab
Gene Symbol Cep120
Ensembl Gene ENSMUSG00000048799
Gene Name centrosomal protein 120
Synonyms Ccdc100
MMRRC Submission 045872-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.773) question?
Stock # R7818 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 53814795-53877680 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 53856175 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 414 (D414G)
Ref Sequence ENSEMBL: ENSMUSP00000062433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049811]
AlphaFold Q7TSG1
Predicted Effect probably benign
Transcript: ENSMUST00000049811
AA Change: D414G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062433
Gene: ENSMUSG00000048799
AA Change: D414G

DomainStartEndE-ValueType
Pfam:C2 9 114 4.8e-5 PFAM
Pfam:DUF3668 118 340 1e-96 PFAM
low complexity region 378 396 N/A INTRINSIC
Pfam:C2 520 568 1.9e-3 PFAM
low complexity region 632 642 N/A INTRINSIC
SCOP:d1eq1a_ 661 803 2e-4 SMART
Meta Mutation Damage Score 0.0618 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions in the microtubule-dependent coupling of the nucleus and the centrosome. A similar protein in mouse plays a role in both interkinetic nuclear migration, which is a characteristic pattern of nuclear movement in neural progenitors, and in neural progenitor self-renewal. Mutations in this gene are predicted to result in neurogenic defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele show embryonic growth arrest at E8.5 and die during organogenesis exhibiting abnormal direction of heart looping. Primary mouse embryonic fibroblasts lack cilia and either one or both centrioles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik T A 9: 46,215,519 (GRCm39) R342S probably benign Het
Aatk C T 11: 119,912,281 (GRCm39) V55I probably benign Het
Abhd10 T A 16: 45,557,916 (GRCm39) I128L probably benign Het
Abraxas1 T A 5: 100,954,176 (GRCm39) M325L probably benign Het
Adgrb2 C A 4: 129,908,353 (GRCm39) L1087I probably damaging Het
Adgrb2 C T 4: 129,908,762 (GRCm39) P1124S possibly damaging Het
Akap9 T A 5: 4,063,875 (GRCm39) Y1741* probably null Het
Ap1g2 A T 14: 55,337,181 (GRCm39) V718D probably benign Het
Asph A T 4: 9,475,015 (GRCm39) M637K probably damaging Het
Atp2c1 T C 9: 105,291,956 (GRCm39) I869V probably benign Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Cacna1e T C 1: 154,274,152 (GRCm39) D2251G probably damaging Het
Camk2b A G 11: 5,927,812 (GRCm39) S413P probably benign Het
Casz1 G A 4: 149,030,533 (GRCm39) C1184Y probably damaging Het
Cbr4 G A 8: 61,940,976 (GRCm39) V32I probably benign Het
Ccdc166 A G 15: 75,852,864 (GRCm39) S368P possibly damaging Het
Ccdc170 A G 10: 4,499,603 (GRCm39) N508S probably benign Het
Ccdc187 A G 2: 26,166,186 (GRCm39) S748P possibly damaging Het
Cdca8 A T 4: 124,820,456 (GRCm39) probably null Het
Dcp1a G T 14: 30,201,678 (GRCm39) A34S probably damaging Het
Ddit3 C T 10: 127,131,662 (GRCm39) T70I probably benign Het
Dlg2 C G 7: 91,589,225 (GRCm39) A313G probably damaging Het
Dnah9 A T 11: 65,916,037 (GRCm39) V2305D possibly damaging Het
Dock1 T A 7: 134,365,594 (GRCm39) D427E probably damaging Het
Dolpp1 T C 2: 30,286,503 (GRCm39) L141P probably benign Het
Dsc2 A T 18: 20,183,189 (GRCm39) D76E probably damaging Het
Dusp7 C A 9: 106,246,329 (GRCm39) N111K probably benign Het
Fam193a A G 5: 34,622,997 (GRCm39) E1195G possibly damaging Het
Fig4 A G 10: 41,139,162 (GRCm39) L347P probably damaging Het
Frem1 T C 4: 82,932,245 (GRCm39) E152G probably damaging Het
Galnt2 G T 8: 125,056,527 (GRCm39) D234Y probably damaging Het
H1f3 C T 13: 23,739,165 (GRCm39) probably benign Het
Igkv4-59 T C 6: 69,415,475 (GRCm39) T27A possibly damaging Het
Ihh T C 1: 74,985,804 (GRCm39) D227G possibly damaging Het
Il1rap T A 16: 26,517,597 (GRCm39) C266S probably damaging Het
Iqcf4 A T 9: 106,447,738 (GRCm39) L57* probably null Het
Kif2b A G 11: 91,466,952 (GRCm39) S444P probably damaging Het
Lmf1 T G 17: 25,881,565 (GRCm39) I538S probably benign Het
Mical2 A G 7: 111,944,514 (GRCm39) Y948C probably damaging Het
Mr1 G A 1: 155,006,382 (GRCm39) Q322* probably null Het
Mroh2a T C 1: 88,162,334 (GRCm39) probably null Het
Mup6 A G 4: 60,004,884 (GRCm39) T100A probably benign Het
Mybpc1 T A 10: 88,394,529 (GRCm39) D266V probably damaging Het
Myocos T C 1: 162,475,063 (GRCm39) N48S unknown Het
Naf1 G A 8: 67,342,028 (GRCm39) G551E probably damaging Het
Nrarp A G 2: 25,071,250 (GRCm39) N43S possibly damaging Het
Or4a80 A G 2: 89,582,288 (GRCm39) S295P possibly damaging Het
Or5p52 G A 7: 107,502,230 (GRCm39) C102Y probably benign Het
Or7a40 A C 16: 16,491,437 (GRCm39) M136R probably damaging Het
Or7g19 T A 9: 18,856,305 (GRCm39) Y120* probably null Het
Or8b57 T A 9: 40,004,008 (GRCm39) M85L probably damaging Het
Padi3 T A 4: 140,525,453 (GRCm39) T177S possibly damaging Het
Pde3b A G 7: 114,090,675 (GRCm39) M305V probably damaging Het
Pde6a T A 18: 61,414,580 (GRCm39) probably null Het
Plscr4 C T 9: 92,372,843 (GRCm39) R322* probably null Het
Prph A G 15: 98,955,753 (GRCm39) T446A probably damaging Het
Pwwp2b T C 7: 138,835,240 (GRCm39) V227A probably benign Het
Rev3l T C 10: 39,699,898 (GRCm39) I1465T possibly damaging Het
Rin1 A G 19: 5,102,219 (GRCm39) S243G probably benign Het
Ripor3 A T 2: 167,831,346 (GRCm39) I485N probably benign Het
Rnpc3 G T 3: 113,423,600 (GRCm39) P35Q probably damaging Het
Sbpl G T 17: 24,172,236 (GRCm39) Q228K unknown Het
Scn11a A C 9: 119,613,177 (GRCm39) N804K probably damaging Het
Selenoo A G 15: 88,981,019 (GRCm39) T453A probably damaging Het
Sez6 C T 11: 77,867,728 (GRCm39) P882S probably damaging Het
Skint5 C T 4: 113,799,923 (GRCm39) R82H possibly damaging Het
Slc18a2 A C 19: 59,251,593 (GRCm39) T115P probably benign Het
Slc1a2 A G 2: 102,574,301 (GRCm39) D237G probably benign Het
Spidr T C 16: 15,932,729 (GRCm39) S184G probably damaging Het
Stag3 A T 5: 138,299,705 (GRCm39) Q872L probably benign Het
Suds3 T C 5: 117,253,814 (GRCm39) probably benign Het
Sv2c T A 13: 96,123,328 (GRCm39) K382* probably null Het
Taf2 T C 15: 54,929,326 (GRCm39) I77V probably benign Het
Tcof1 G C 18: 60,962,123 (GRCm39) A702G possibly damaging Het
Tdrd3 G T 14: 87,709,636 (GRCm39) C100F probably damaging Het
Tek T A 4: 94,715,953 (GRCm39) H458Q possibly damaging Het
Tes C A 6: 17,099,743 (GRCm39) P246Q probably damaging Het
Tgif1 A T 17: 71,156,603 (GRCm39) probably null Het
Tlr11 A T 14: 50,599,285 (GRCm39) N424Y probably damaging Het
Tmc8 A T 11: 117,682,953 (GRCm39) N626I probably damaging Het
Tmem132c T A 5: 127,641,152 (GRCm39) *1108K probably null Het
Tnks A T 8: 35,340,182 (GRCm39) Y479N probably benign Het
Trip12 C T 1: 84,738,527 (GRCm39) G776D probably damaging Het
Tssk1 A G 16: 17,712,311 (GRCm39) E32G probably benign Het
Ube2o T C 11: 116,434,736 (GRCm39) D575G probably damaging Het
Uckl1 A T 2: 181,216,460 (GRCm39) M16K probably damaging Het
Zfp948 A T 17: 21,807,985 (GRCm39) E392D probably benign Het
Zmynd8 G A 2: 165,684,751 (GRCm39) T167I probably damaging Het
Other mutations in Cep120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Cep120 APN 18 53,819,033 (GRCm39) missense probably benign 0.24
IGL01774:Cep120 APN 18 53,839,902 (GRCm39) missense possibly damaging 0.92
IGL01862:Cep120 APN 18 53,847,839 (GRCm39) missense probably benign 0.01
IGL01906:Cep120 APN 18 53,847,984 (GRCm39) missense probably benign
IGL01941:Cep120 APN 18 53,856,220 (GRCm39) missense probably benign 0.00
IGL02952:Cep120 APN 18 53,816,300 (GRCm39) utr 3 prime probably benign
IGL03248:Cep120 APN 18 53,868,844 (GRCm39) missense probably benign 0.04
IGL03379:Cep120 APN 18 53,842,208 (GRCm39) missense probably benign
R0019:Cep120 UTSW 18 53,842,119 (GRCm39) splice site probably benign
R0039:Cep120 UTSW 18 53,819,033 (GRCm39) missense probably benign 0.24
R0763:Cep120 UTSW 18 53,854,809 (GRCm39) missense probably benign 0.00
R1015:Cep120 UTSW 18 53,836,193 (GRCm39) critical splice donor site probably null
R1340:Cep120 UTSW 18 53,857,463 (GRCm39) missense probably damaging 1.00
R1507:Cep120 UTSW 18 53,830,729 (GRCm39) missense probably damaging 0.99
R1649:Cep120 UTSW 18 53,857,648 (GRCm39) missense probably damaging 1.00
R1727:Cep120 UTSW 18 53,860,801 (GRCm39) missense probably benign 0.01
R1739:Cep120 UTSW 18 53,852,286 (GRCm39) critical splice donor site probably null
R1873:Cep120 UTSW 18 53,871,560 (GRCm39) missense probably damaging 0.98
R1913:Cep120 UTSW 18 53,856,358 (GRCm39) missense probably benign 0.26
R1968:Cep120 UTSW 18 53,856,313 (GRCm39) missense probably benign 0.42
R1995:Cep120 UTSW 18 53,873,208 (GRCm39) missense probably damaging 1.00
R2042:Cep120 UTSW 18 53,868,814 (GRCm39) missense possibly damaging 0.50
R2074:Cep120 UTSW 18 53,852,384 (GRCm39) missense possibly damaging 0.83
R2116:Cep120 UTSW 18 53,873,208 (GRCm39) missense probably damaging 1.00
R2215:Cep120 UTSW 18 53,860,707 (GRCm39) missense probably damaging 1.00
R2697:Cep120 UTSW 18 53,873,197 (GRCm39) missense probably benign 0.00
R3813:Cep120 UTSW 18 53,873,284 (GRCm39) splice site probably benign
R4012:Cep120 UTSW 18 53,871,654 (GRCm39) missense probably damaging 0.99
R4368:Cep120 UTSW 18 53,818,957 (GRCm39) splice site probably null
R4615:Cep120 UTSW 18 53,847,913 (GRCm39) missense probably damaging 1.00
R4772:Cep120 UTSW 18 53,851,561 (GRCm39) missense probably damaging 1.00
R4780:Cep120 UTSW 18 53,857,608 (GRCm39) missense probably benign 0.12
R5195:Cep120 UTSW 18 53,854,770 (GRCm39) missense probably damaging 1.00
R5991:Cep120 UTSW 18 53,854,870 (GRCm39) missense probably benign
R6156:Cep120 UTSW 18 53,836,295 (GRCm39) missense probably benign 0.00
R6188:Cep120 UTSW 18 53,857,529 (GRCm39) missense probably benign 0.03
R6688:Cep120 UTSW 18 53,857,608 (GRCm39) missense probably benign 0.12
R6961:Cep120 UTSW 18 53,836,277 (GRCm39) nonsense probably null
R7143:Cep120 UTSW 18 53,816,457 (GRCm39) missense probably benign 0.00
R7282:Cep120 UTSW 18 53,873,161 (GRCm39) missense probably damaging 1.00
R7813:Cep120 UTSW 18 53,871,578 (GRCm39) missense probably damaging 1.00
R8677:Cep120 UTSW 18 53,871,633 (GRCm39) missense possibly damaging 0.90
R8724:Cep120 UTSW 18 53,856,199 (GRCm39) missense possibly damaging 0.88
R9164:Cep120 UTSW 18 53,852,318 (GRCm39) missense probably benign 0.02
R9225:Cep120 UTSW 18 53,839,896 (GRCm39) missense probably benign 0.00
R9300:Cep120 UTSW 18 53,852,369 (GRCm39) missense probably damaging 0.99
R9312:Cep120 UTSW 18 53,860,713 (GRCm39) missense probably benign 0.08
R9377:Cep120 UTSW 18 53,851,592 (GRCm39) missense possibly damaging 0.66
R9390:Cep120 UTSW 18 53,839,984 (GRCm39) nonsense probably null
R9499:Cep120 UTSW 18 53,819,033 (GRCm39) missense possibly damaging 0.94
R9551:Cep120 UTSW 18 53,819,033 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCCAAATGAAGCCTGTGGTTTTC -3'
(R):5'- ACCCAGAATGGACATGAGGC -3'

Sequencing Primer
(F):5'- TCTCACAGATGTTCTCAGACAGG -3'
(R):5'- TGGACATGAGGCAGAACATTCAC -3'
Posted On 2019-12-03