Incidental Mutation 'R7819:Gpsm1'
ID 601717
Institutional Source Beutler Lab
Gene Symbol Gpsm1
Ensembl Gene ENSMUSG00000026930
Gene Name G-protein signalling modulator 1 (AGS3-like, C. elegans)
Synonyms Ags3, 1810037C22Rik
MMRRC Submission 045873-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7819 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 26205527-26238249 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 26229705 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 42 (L42P)
Ref Sequence ENSEMBL: ENSMUSP00000109769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066889] [ENSMUST00000066936] [ENSMUST00000078616] [ENSMUST00000114134] [ENSMUST00000127453]
AlphaFold Q6IR34
Predicted Effect probably benign
Transcript: ENSMUST00000066889
AA Change: L451P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000067964
Gene: ENSMUSG00000026930
AA Change: L451P

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
TPR 98 131 1.45e-1 SMART
TPR 138 171 7.06e-5 SMART
TPR 238 271 5.96e-3 SMART
TPR 278 311 1.47e-2 SMART
TPR 318 351 5.19e-3 SMART
TPR 358 391 1.33e0 SMART
GoLoco 525 547 7.38e-9 SMART
low complexity region 548 560 N/A INTRINSIC
GoLoco 578 600 4.24e-9 SMART
GoLoco 626 648 5.22e-9 SMART
GoLoco 660 682 3.58e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066936
AA Change: L419P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000065000
Gene: ENSMUSG00000026930
AA Change: L419P

DomainStartEndE-ValueType
TPR 66 99 1.45e-1 SMART
TPR 106 139 7.06e-5 SMART
TPR 206 239 5.96e-3 SMART
TPR 246 279 1.47e-2 SMART
TPR 286 319 5.19e-3 SMART
TPR 326 359 1.33e0 SMART
GoLoco 493 515 7.38e-9 SMART
low complexity region 516 528 N/A INTRINSIC
GoLoco 546 568 4.24e-9 SMART
GoLoco 594 616 5.22e-9 SMART
GoLoco 628 650 3.58e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078616
AA Change: L419P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000077686
Gene: ENSMUSG00000026930
AA Change: L419P

DomainStartEndE-ValueType
TPR 66 99 1.45e-1 SMART
TPR 106 139 7.06e-5 SMART
TPR 206 239 5.96e-3 SMART
TPR 246 279 1.47e-2 SMART
TPR 286 319 5.19e-3 SMART
TPR 326 359 1.33e0 SMART
GoLoco 433 455 7.38e-9 SMART
low complexity region 456 468 N/A INTRINSIC
GoLoco 486 508 4.24e-9 SMART
GoLoco 534 556 5.22e-9 SMART
GoLoco 568 590 3.58e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114134
AA Change: L42P

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109769
Gene: ENSMUSG00000026930
AA Change: L42P

DomainStartEndE-ValueType
GoLoco 56 78 7.38e-9 SMART
low complexity region 79 91 N/A INTRINSIC
GoLoco 109 131 4.24e-9 SMART
GoLoco 157 179 5.22e-9 SMART
GoLoco 191 213 3.58e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127453
AA Change: L42P

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect
SMART Domains Protein: ENSMUSP00000115680
Gene: ENSMUSG00000026930
AA Change: L242P

DomainStartEndE-ValueType
Blast:TPR 22 68 1e-9 BLAST
Pfam:TPR_1 82 107 2.3e-4 PFAM
Pfam:TPR_12 82 147 7.9e-12 PFAM
Pfam:TPR_7 84 119 1.4e-5 PFAM
Pfam:TPR_2 122 147 6.2e-4 PFAM
Pfam:TPR_8 123 146 1.4e-2 PFAM
Blast:TPR 150 183 4e-15 BLAST
GoLoco 317 339 7.38e-9 SMART
low complexity region 340 352 N/A INTRINSIC
GoLoco 370 392 4.24e-9 SMART
GoLoco 418 440 5.22e-9 SMART
GoLoco 452 474 3.58e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] G-protein signaling modulators (GPSMs) play diverse functional roles through their interaction with G-protein subunits. This gene encodes a receptor-independent activator of G protein signaling, which is one of several factors that influence the basal activity of G-protein signaling systems. The protein contains seven tetratricopeptide repeats in its N-terminal half and four G-protein regulatory (GPR) motifs in its C-terminal half. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a lean phenotype, reduced fat mass, increased food consumption, increased nocturnal energy expenditure and altered blood pressure control mechanisms; surprisingly, their basal behavior and gross brain morphology remain normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik C G 6: 52,156,254 (GRCm39) probably benign Het
Abcg3 T C 5: 105,125,594 (GRCm39) T30A probably benign Het
Adra1b A T 11: 43,726,194 (GRCm39) V241D probably damaging Het
Ahctf1 A T 1: 179,595,880 (GRCm39) N170K probably benign Het
Ahr A G 12: 35,559,999 (GRCm39) L218P probably damaging Het
Apol8 C T 15: 77,633,959 (GRCm39) V206M probably damaging Het
Arhgap11a T A 2: 113,665,263 (GRCm39) probably null Het
B3galnt1 T C 3: 69,483,108 (GRCm39) Y51C probably damaging Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Capn3 T C 2: 120,294,646 (GRCm39) V98A probably benign Het
Casp12 T C 9: 5,352,805 (GRCm39) L209P probably damaging Het
Ccdc96 A T 5: 36,643,329 (GRCm39) Q445L probably damaging Het
Cdc37 A G 9: 21,052,260 (GRCm39) S301P probably damaging Het
Cep89 A T 7: 35,131,968 (GRCm39) H634L probably benign Het
Cert1 A T 13: 96,765,575 (GRCm39) T447S possibly damaging Het
Cfap251 A G 5: 123,392,322 (GRCm39) probably benign Het
Chmp3 T A 6: 71,538,008 (GRCm39) Y12* probably null Het
Clgn A T 8: 84,134,829 (GRCm39) I156F possibly damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 105,036,334 (GRCm39) probably null Het
Crb2 T A 2: 37,681,603 (GRCm39) N815K probably benign Het
Crppa A G 12: 36,431,902 (GRCm39) T44A probably benign Het
Csgalnact2 A C 6: 118,098,050 (GRCm39) L97V possibly damaging Het
Ctsh T A 9: 89,942,556 (GRCm39) M37K possibly damaging Het
D630003M21Rik T C 2: 158,058,718 (GRCm39) E394G probably damaging Het
Ddx31 T G 2: 28,782,463 (GRCm39) L602R probably damaging Het
Defb40 T A 8: 19,025,050 (GRCm39) Y52F probably benign Het
Dip2a A G 10: 76,126,862 (GRCm39) V710A probably benign Het
Dnah2 T C 11: 69,407,419 (GRCm39) I150V probably benign Het
Eln A T 5: 134,766,035 (GRCm39) L56Q unknown Het
Ezh1 T C 11: 101,085,740 (GRCm39) N639S probably damaging Het
Fzd3 A G 14: 65,472,775 (GRCm39) F331S probably damaging Het
Gbp9 T C 5: 105,251,745 (GRCm39) T68A possibly damaging Het
Gltp A G 5: 114,812,161 (GRCm39) M104T probably benign Het
Gmps G A 3: 63,893,048 (GRCm39) V118M probably damaging Het
Hsfy2 T A 1: 56,675,418 (GRCm39) H373L probably benign Het
Ica1l A T 1: 60,054,953 (GRCm39) F93I possibly damaging Het
Idh1 A G 1: 65,204,277 (GRCm39) S278P probably damaging Het
Ighmbp2 C T 19: 3,317,276 (GRCm39) G532D possibly damaging Het
Ikbkb A G 8: 23,161,742 (GRCm39) L382S probably benign Het
Il1rap T A 16: 26,541,151 (GRCm39) M464K possibly damaging Het
Ing2 G A 8: 48,122,063 (GRCm39) R162C probably damaging Het
Ints1 A T 5: 139,746,522 (GRCm39) L1275H probably damaging Het
Itga1 T C 13: 115,185,837 (GRCm39) E55G probably damaging Het
Itih4 T C 14: 30,623,620 (GRCm39) F930L probably benign Het
Kcnh8 A G 17: 53,263,743 (GRCm39) T747A probably benign Het
Kit A G 5: 75,806,592 (GRCm39) E699G probably benign Het
Lamc3 T C 2: 31,811,775 (GRCm39) S921P probably benign Het
Lrrc63 TGGCGGCGGCGGCGGCGGCGGC TGGCGGCGGCGGCGGCGGCGGCGGC 14: 75,362,661 (GRCm39) probably benign Het
Map10 TCAGTTGTCCAG TCAG 8: 126,397,260 (GRCm39) probably null Het
Map2k5 T C 9: 63,265,300 (GRCm39) E76G probably damaging Het
Mgat3 G T 15: 80,095,973 (GRCm39) E267* probably null Het
Nhsl3 A G 4: 129,116,276 (GRCm39) V841A probably benign Het
Npepps C A 11: 97,139,095 (GRCm39) G159V probably damaging Het
Nrap A G 19: 56,323,720 (GRCm39) V1284A probably benign Het
Or10a3 T A 7: 108,480,610 (GRCm39) I68F probably damaging Het
Or6c66b A T 10: 129,376,562 (GRCm39) H52L probably benign Het
Oxgr1 T C 14: 120,260,281 (GRCm39) probably null Het
Pcdhb18 T C 18: 37,624,308 (GRCm39) L546P possibly damaging Het
Pcdhga5 G A 18: 37,829,633 (GRCm39) V694M probably damaging Het
Pde9a A T 17: 31,679,174 (GRCm39) I255F possibly damaging Het
Pi4k2a G A 19: 42,079,013 (GRCm39) G25R probably benign Het
Plscr4 C T 9: 92,372,843 (GRCm39) R322* probably null Het
Ppp1r37 A G 7: 19,267,989 (GRCm39) I302T probably damaging Het
Prkar2a T A 9: 108,622,744 (GRCm39) Y311N probably damaging Het
Prkd3 A T 17: 79,279,930 (GRCm39) D254E probably benign Het
Prmt9 T C 8: 78,294,973 (GRCm39) V439A probably benign Het
Ptpra T C 2: 130,346,126 (GRCm39) S96P probably benign Het
Rnf103 A G 6: 71,485,914 (GRCm39) T182A probably benign Het
Rpusd4 A G 9: 35,179,228 (GRCm39) S15G probably benign Het
Sco1 A G 11: 66,949,219 (GRCm39) Y229C probably damaging Het
Skint5 T A 4: 113,417,032 (GRCm39) Q1139L unknown Het
Slc16a12 A G 19: 34,652,579 (GRCm39) V189A probably damaging Het
Slfn8 T G 11: 82,895,081 (GRCm39) N575T probably damaging Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Stard9 T C 2: 120,531,465 (GRCm39) L2574P probably damaging Het
Syn3 A T 10: 85,891,404 (GRCm39) probably benign Het
Tspo2 A T 17: 48,756,985 (GRCm39) D32E probably damaging Het
Vmn1r72 A G 7: 11,403,552 (GRCm39) F299L probably benign Het
Xbp1 G A 11: 5,474,886 (GRCm39) M262I probably benign Het
Zfp354b G A 11: 50,814,632 (GRCm39) Q98* probably null Het
Zfp582 A C 7: 6,357,165 (GRCm39) H326P probably damaging Het
Other mutations in Gpsm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01803:Gpsm1 APN 2 26,236,921 (GRCm39) missense probably damaging 1.00
IGL01826:Gpsm1 APN 2 26,216,314 (GRCm39) missense probably damaging 0.98
IGL02281:Gpsm1 APN 2 26,229,638 (GRCm39) splice site probably benign
IGL02730:Gpsm1 APN 2 26,215,390 (GRCm39) missense probably benign 0.13
IGL02740:Gpsm1 APN 2 26,230,585 (GRCm39) missense probably benign 0.43
IGL02749:Gpsm1 APN 2 26,229,687 (GRCm39) missense probably damaging 0.99
IGL02982:Gpsm1 APN 2 26,214,871 (GRCm39) missense probably damaging 1.00
R1271:Gpsm1 UTSW 2 26,234,684 (GRCm39) missense probably damaging 0.99
R1639:Gpsm1 UTSW 2 26,235,199 (GRCm39) missense probably damaging 1.00
R1766:Gpsm1 UTSW 2 26,215,395 (GRCm39) missense probably damaging 1.00
R1854:Gpsm1 UTSW 2 26,234,725 (GRCm39) missense probably damaging 1.00
R2900:Gpsm1 UTSW 2 26,235,174 (GRCm39) missense probably benign 0.00
R2994:Gpsm1 UTSW 2 26,209,843 (GRCm39) unclassified probably benign
R2995:Gpsm1 UTSW 2 26,209,843 (GRCm39) unclassified probably benign
R2996:Gpsm1 UTSW 2 26,209,843 (GRCm39) unclassified probably benign
R4227:Gpsm1 UTSW 2 26,229,638 (GRCm39) splice site probably benign
R4391:Gpsm1 UTSW 2 26,214,009 (GRCm39) missense probably damaging 1.00
R4413:Gpsm1 UTSW 2 26,209,843 (GRCm39) unclassified probably benign
R4461:Gpsm1 UTSW 2 26,209,843 (GRCm39) unclassified probably benign
R4469:Gpsm1 UTSW 2 26,209,843 (GRCm39) unclassified probably benign
R4659:Gpsm1 UTSW 2 26,209,843 (GRCm39) unclassified probably benign
R4786:Gpsm1 UTSW 2 26,212,493 (GRCm39) missense probably benign 0.01
R5025:Gpsm1 UTSW 2 26,210,008 (GRCm39) missense possibly damaging 0.90
R5057:Gpsm1 UTSW 2 26,215,369 (GRCm39) missense probably damaging 0.96
R5171:Gpsm1 UTSW 2 26,217,476 (GRCm39) intron probably benign
R5356:Gpsm1 UTSW 2 26,230,574 (GRCm39) missense possibly damaging 0.73
R5417:Gpsm1 UTSW 2 26,214,045 (GRCm39) critical splice donor site probably null
R5967:Gpsm1 UTSW 2 26,230,546 (GRCm39) splice site probably null
R6153:Gpsm1 UTSW 2 26,215,425 (GRCm39) missense probably benign 0.14
R6969:Gpsm1 UTSW 2 26,230,555 (GRCm39) missense probably benign 0.01
R7006:Gpsm1 UTSW 2 26,212,572 (GRCm39) missense probably damaging 1.00
R7867:Gpsm1 UTSW 2 26,230,448 (GRCm39) missense probably benign 0.38
R8194:Gpsm1 UTSW 2 26,217,364 (GRCm39) frame shift probably null
R8195:Gpsm1 UTSW 2 26,214,929 (GRCm39) splice site probably null
R8857:Gpsm1 UTSW 2 26,230,457 (GRCm39) missense possibly damaging 0.47
R9267:Gpsm1 UTSW 2 26,236,835 (GRCm39) missense probably damaging 1.00
R9281:Gpsm1 UTSW 2 26,214,488 (GRCm39) missense probably damaging 0.99
RF017:Gpsm1 UTSW 2 26,214,884 (GRCm39) missense probably damaging 1.00
Z1176:Gpsm1 UTSW 2 26,217,357 (GRCm39) missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- AGTGACTCTGTGGACACTCG -3'
(R):5'- AAATAGGTTCCTGTGGGGCC -3'

Sequencing Primer
(F):5'- CTTCACAAGAAGGGATGTGTGAACTC -3'
(R):5'- GCACACTGGGCTCATTAA -3'
Posted On 2019-12-03