Incidental Mutation 'R7819:Ddx31'
ID 601718
Institutional Source Beutler Lab
Gene Symbol Ddx31
Ensembl Gene ENSMUSG00000026806
Gene Name DEAD/H box helicase 31
Synonyms 5830444G11Rik, DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31
MMRRC Submission 045873-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.855) question?
Stock # R7819 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 28730418-28795583 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 28782463 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 602 (L602R)
Ref Sequence ENSEMBL: ENSMUSP00000109484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113853]
AlphaFold Q6NZQ2
Predicted Effect probably damaging
Transcript: ENSMUST00000113853
AA Change: L602R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109484
Gene: ENSMUSG00000026806
AA Change: L602R

DomainStartEndE-ValueType
DEXDc 123 332 2.28e-48 SMART
HELICc 408 487 4.02e-26 SMART
DUF4217 556 621 6.21e-22 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik C G 6: 52,156,254 (GRCm39) probably benign Het
Abcg3 T C 5: 105,125,594 (GRCm39) T30A probably benign Het
Adra1b A T 11: 43,726,194 (GRCm39) V241D probably damaging Het
Ahctf1 A T 1: 179,595,880 (GRCm39) N170K probably benign Het
Ahr A G 12: 35,559,999 (GRCm39) L218P probably damaging Het
Apol8 C T 15: 77,633,959 (GRCm39) V206M probably damaging Het
Arhgap11a T A 2: 113,665,263 (GRCm39) probably null Het
B3galnt1 T C 3: 69,483,108 (GRCm39) Y51C probably damaging Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Capn3 T C 2: 120,294,646 (GRCm39) V98A probably benign Het
Casp12 T C 9: 5,352,805 (GRCm39) L209P probably damaging Het
Ccdc96 A T 5: 36,643,329 (GRCm39) Q445L probably damaging Het
Cdc37 A G 9: 21,052,260 (GRCm39) S301P probably damaging Het
Cep89 A T 7: 35,131,968 (GRCm39) H634L probably benign Het
Cert1 A T 13: 96,765,575 (GRCm39) T447S possibly damaging Het
Cfap251 A G 5: 123,392,322 (GRCm39) probably benign Het
Chmp3 T A 6: 71,538,008 (GRCm39) Y12* probably null Het
Clgn A T 8: 84,134,829 (GRCm39) I156F possibly damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 105,036,334 (GRCm39) probably null Het
Crb2 T A 2: 37,681,603 (GRCm39) N815K probably benign Het
Crppa A G 12: 36,431,902 (GRCm39) T44A probably benign Het
Csgalnact2 A C 6: 118,098,050 (GRCm39) L97V possibly damaging Het
Ctsh T A 9: 89,942,556 (GRCm39) M37K possibly damaging Het
D630003M21Rik T C 2: 158,058,718 (GRCm39) E394G probably damaging Het
Defb40 T A 8: 19,025,050 (GRCm39) Y52F probably benign Het
Dip2a A G 10: 76,126,862 (GRCm39) V710A probably benign Het
Dnah2 T C 11: 69,407,419 (GRCm39) I150V probably benign Het
Eln A T 5: 134,766,035 (GRCm39) L56Q unknown Het
Ezh1 T C 11: 101,085,740 (GRCm39) N639S probably damaging Het
Fzd3 A G 14: 65,472,775 (GRCm39) F331S probably damaging Het
Gbp9 T C 5: 105,251,745 (GRCm39) T68A possibly damaging Het
Gltp A G 5: 114,812,161 (GRCm39) M104T probably benign Het
Gmps G A 3: 63,893,048 (GRCm39) V118M probably damaging Het
Gpsm1 T C 2: 26,229,705 (GRCm39) L42P probably damaging Het
Hsfy2 T A 1: 56,675,418 (GRCm39) H373L probably benign Het
Ica1l A T 1: 60,054,953 (GRCm39) F93I possibly damaging Het
Idh1 A G 1: 65,204,277 (GRCm39) S278P probably damaging Het
Ighmbp2 C T 19: 3,317,276 (GRCm39) G532D possibly damaging Het
Ikbkb A G 8: 23,161,742 (GRCm39) L382S probably benign Het
Il1rap T A 16: 26,541,151 (GRCm39) M464K possibly damaging Het
Ing2 G A 8: 48,122,063 (GRCm39) R162C probably damaging Het
Ints1 A T 5: 139,746,522 (GRCm39) L1275H probably damaging Het
Itga1 T C 13: 115,185,837 (GRCm39) E55G probably damaging Het
Itih4 T C 14: 30,623,620 (GRCm39) F930L probably benign Het
Kcnh8 A G 17: 53,263,743 (GRCm39) T747A probably benign Het
Kit A G 5: 75,806,592 (GRCm39) E699G probably benign Het
Lamc3 T C 2: 31,811,775 (GRCm39) S921P probably benign Het
Lrrc63 TGGCGGCGGCGGCGGCGGCGGC TGGCGGCGGCGGCGGCGGCGGCGGC 14: 75,362,661 (GRCm39) probably benign Het
Map10 TCAGTTGTCCAG TCAG 8: 126,397,260 (GRCm39) probably null Het
Map2k5 T C 9: 63,265,300 (GRCm39) E76G probably damaging Het
Mgat3 G T 15: 80,095,973 (GRCm39) E267* probably null Het
Nhsl3 A G 4: 129,116,276 (GRCm39) V841A probably benign Het
Npepps C A 11: 97,139,095 (GRCm39) G159V probably damaging Het
Nrap A G 19: 56,323,720 (GRCm39) V1284A probably benign Het
Or10a3 T A 7: 108,480,610 (GRCm39) I68F probably damaging Het
Or6c66b A T 10: 129,376,562 (GRCm39) H52L probably benign Het
Oxgr1 T C 14: 120,260,281 (GRCm39) probably null Het
Pcdhb18 T C 18: 37,624,308 (GRCm39) L546P possibly damaging Het
Pcdhga5 G A 18: 37,829,633 (GRCm39) V694M probably damaging Het
Pde9a A T 17: 31,679,174 (GRCm39) I255F possibly damaging Het
Pi4k2a G A 19: 42,079,013 (GRCm39) G25R probably benign Het
Plscr4 C T 9: 92,372,843 (GRCm39) R322* probably null Het
Ppp1r37 A G 7: 19,267,989 (GRCm39) I302T probably damaging Het
Prkar2a T A 9: 108,622,744 (GRCm39) Y311N probably damaging Het
Prkd3 A T 17: 79,279,930 (GRCm39) D254E probably benign Het
Prmt9 T C 8: 78,294,973 (GRCm39) V439A probably benign Het
Ptpra T C 2: 130,346,126 (GRCm39) S96P probably benign Het
Rnf103 A G 6: 71,485,914 (GRCm39) T182A probably benign Het
Rpusd4 A G 9: 35,179,228 (GRCm39) S15G probably benign Het
Sco1 A G 11: 66,949,219 (GRCm39) Y229C probably damaging Het
Skint5 T A 4: 113,417,032 (GRCm39) Q1139L unknown Het
Slc16a12 A G 19: 34,652,579 (GRCm39) V189A probably damaging Het
Slfn8 T G 11: 82,895,081 (GRCm39) N575T probably damaging Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Stard9 T C 2: 120,531,465 (GRCm39) L2574P probably damaging Het
Syn3 A T 10: 85,891,404 (GRCm39) probably benign Het
Tspo2 A T 17: 48,756,985 (GRCm39) D32E probably damaging Het
Vmn1r72 A G 7: 11,403,552 (GRCm39) F299L probably benign Het
Xbp1 G A 11: 5,474,886 (GRCm39) M262I probably benign Het
Zfp354b G A 11: 50,814,632 (GRCm39) Q98* probably null Het
Zfp582 A C 7: 6,357,165 (GRCm39) H326P probably damaging Het
Other mutations in Ddx31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01664:Ddx31 APN 2 28,765,847 (GRCm39) splice site probably benign
IGL01918:Ddx31 APN 2 28,764,176 (GRCm39) missense probably damaging 1.00
IGL02174:Ddx31 APN 2 28,749,041 (GRCm39) missense probably damaging 1.00
IGL02560:Ddx31 APN 2 28,765,838 (GRCm39) missense probably damaging 1.00
IGL02938:Ddx31 APN 2 28,749,035 (GRCm39) missense possibly damaging 0.49
R0241:Ddx31 UTSW 2 28,738,303 (GRCm39) missense probably damaging 1.00
R0241:Ddx31 UTSW 2 28,738,303 (GRCm39) missense probably damaging 1.00
R0440:Ddx31 UTSW 2 28,747,144 (GRCm39) missense probably damaging 1.00
R0701:Ddx31 UTSW 2 28,748,789 (GRCm39) missense probably null 1.00
R0729:Ddx31 UTSW 2 28,764,186 (GRCm39) missense probably damaging 1.00
R1227:Ddx31 UTSW 2 28,747,187 (GRCm39) missense probably damaging 1.00
R1532:Ddx31 UTSW 2 28,771,171 (GRCm39) missense probably benign 0.00
R1608:Ddx31 UTSW 2 28,749,078 (GRCm39) missense probably damaging 0.97
R1646:Ddx31 UTSW 2 28,782,532 (GRCm39) missense probably benign
R1674:Ddx31 UTSW 2 28,748,828 (GRCm39) missense probably damaging 1.00
R1834:Ddx31 UTSW 2 28,782,465 (GRCm39) missense probably damaging 1.00
R1884:Ddx31 UTSW 2 28,749,002 (GRCm39) missense probably damaging 0.97
R4133:Ddx31 UTSW 2 28,748,864 (GRCm39) missense probably damaging 1.00
R4911:Ddx31 UTSW 2 28,794,696 (GRCm39) missense probably benign 0.00
R4972:Ddx31 UTSW 2 28,750,782 (GRCm39) missense probably damaging 1.00
R5240:Ddx31 UTSW 2 28,736,042 (GRCm39) missense probably benign 0.03
R5358:Ddx31 UTSW 2 28,753,782 (GRCm39) missense probably damaging 0.98
R5450:Ddx31 UTSW 2 28,776,981 (GRCm39) missense probably damaging 0.97
R5945:Ddx31 UTSW 2 28,749,902 (GRCm39) missense probably damaging 1.00
R5956:Ddx31 UTSW 2 28,764,185 (GRCm39) missense probably damaging 1.00
R6235:Ddx31 UTSW 2 28,734,854 (GRCm39) missense probably benign 0.00
R6245:Ddx31 UTSW 2 28,734,994 (GRCm39) missense probably benign 0.00
R6463:Ddx31 UTSW 2 28,737,525 (GRCm39) critical splice donor site probably null
R6647:Ddx31 UTSW 2 28,765,750 (GRCm39) missense probably damaging 1.00
R6783:Ddx31 UTSW 2 28,764,188 (GRCm39) missense probably benign 0.26
R6917:Ddx31 UTSW 2 28,782,421 (GRCm39) missense probably damaging 1.00
R7135:Ddx31 UTSW 2 28,738,318 (GRCm39) missense probably benign
R8812:Ddx31 UTSW 2 28,730,816 (GRCm39) unclassified probably benign
R9122:Ddx31 UTSW 2 28,748,753 (GRCm39) missense probably damaging 1.00
R9326:Ddx31 UTSW 2 28,749,008 (GRCm39) missense probably damaging 1.00
R9571:Ddx31 UTSW 2 28,750,034 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAATGTGCCTGTGTTATAGTCGTC -3'
(R):5'- TCTGTACTGAAGACAGGCAGAC -3'

Sequencing Primer
(F):5'- CCTGGTTCTGTTCTTTCTAGGCAAG -3'
(R):5'- CAGGCAGACACTAGTGGTAATTTATC -3'
Posted On 2019-12-03