Incidental Mutation 'R7819:Crb2'
ID601720
Institutional Source Beutler Lab
Gene Symbol Crb2
Ensembl Gene ENSMUSG00000035403
Gene Namecrumbs family member 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7819 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location37776249-37799103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37791591 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 815 (N815K)
Ref Sequence ENSEMBL: ENSMUSP00000058007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050372]
Predicted Effect probably benign
Transcript: ENSMUST00000050372
AA Change: N815K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000058007
Gene: ENSMUSG00000035403
AA Change: N815K

DomainStartEndE-ValueType
EGF 74 110 1.92e-7 SMART
EGF_CA 112 148 1.69e-12 SMART
EGF_CA 150 186 3.99e-14 SMART
EGF_CA 188 225 8.9e-12 SMART
EGF_CA 227 263 3.79e-6 SMART
EGF 268 322 1.32e-5 SMART
EGF_CA 324 360 5.96e-13 SMART
EGF_CA 362 398 2.54e-7 SMART
EGF 403 440 2.45e0 SMART
low complexity region 446 457 N/A INTRINSIC
LamG 461 592 1.18e-6 SMART
EGF 612 645 4.59e-5 SMART
LamG 671 778 4.45e-2 SMART
EGF 813 846 5.2e-4 SMART
LamG 893 1019 1.68e-1 SMART
EGF 1056 1089 9.55e-3 SMART
EGF 1094 1127 9.85e-5 SMART
EGF 1134 1168 1.91e1 SMART
EGF 1173 1206 3.73e-5 SMART
transmembrane domain 1222 1244 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that are components of the Crumbs cell polarity complex. In mammals, members of this family are thought to play a role in many cellular processes in early embryonic development. A similar protein in Drosophila determines apicobasal polarity in embryonic epithelial cells. Mutations in this gene are associated with focal segmental glomerulosclerosis 9, and with ventriculomegaly with cystic kidney disease. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous inactivation of this gene causes severe gastrulation defects, impaired somitogenesis and organogenesis. and complete embryonic death by E12.5. Several organ primordia, including neuroepithelium, gut, and heart, fail to form properly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik C G 6: 52,179,274 probably benign Het
Abcg3 T C 5: 104,977,728 T30A probably benign Het
Adra1b A T 11: 43,835,367 V241D probably damaging Het
Ahctf1 A T 1: 179,768,315 N170K probably benign Het
Ahr A G 12: 35,510,000 L218P probably damaging Het
Apol8 C T 15: 77,749,759 V206M probably damaging Het
Arhgap11a T A 2: 113,834,918 probably null Het
B3galnt1 T C 3: 69,575,775 Y51C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C77080 A G 4: 129,222,483 V841A probably benign Het
Capn3 T C 2: 120,464,165 V98A probably benign Het
Casp12 T C 9: 5,352,805 L209P probably damaging Het
Ccdc96 A T 5: 36,485,985 Q445L probably damaging Het
Cdc37 A G 9: 21,140,964 S301P probably damaging Het
Cep89 A T 7: 35,432,543 H634L probably benign Het
Chmp3 T A 6: 71,561,024 Y12* probably null Het
Clgn A T 8: 83,408,200 I156F possibly damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
Col4a3bp A T 13: 96,629,067 T447S possibly damaging Het
Csgalnact2 A C 6: 118,121,089 L97V possibly damaging Het
Ctsh T A 9: 90,060,503 M37K possibly damaging Het
D630003M21Rik T C 2: 158,216,798 E394G probably damaging Het
Ddx31 T G 2: 28,892,451 L602R probably damaging Het
Defb40 T A 8: 18,975,034 Y52F probably benign Het
Dip2a A G 10: 76,291,028 V710A probably benign Het
Dnah2 T C 11: 69,516,593 I150V probably benign Het
Eln A T 5: 134,737,181 L56Q unknown Het
Ezh1 T C 11: 101,194,914 N639S probably damaging Het
Fzd3 A G 14: 65,235,326 F331S probably damaging Het
Gbp9 T C 5: 105,103,879 T68A possibly damaging Het
Gltp A G 5: 114,674,100 M104T probably benign Het
Gm3854 A C 7: 6,354,166 H326P probably damaging Het
Gmps G A 3: 63,985,627 V118M probably damaging Het
Gpsm1 T C 2: 26,339,693 L42P probably damaging Het
Hsfy2 T A 1: 56,636,259 H373L probably benign Het
Ica1l A T 1: 60,015,794 F93I possibly damaging Het
Idh1 A G 1: 65,165,118 S278P probably damaging Het
Ighmbp2 C T 19: 3,267,276 G532D possibly damaging Het
Ikbkb A G 8: 22,671,726 L382S probably benign Het
Il1rap T A 16: 26,722,401 M464K possibly damaging Het
Ing2 G A 8: 47,669,028 R162C probably damaging Het
Ints1 A T 5: 139,760,767 L1275H probably damaging Het
Ispd A G 12: 36,381,903 T44A probably benign Het
Itga1 T C 13: 115,049,301 E55G probably damaging Het
Itih4 T C 14: 30,901,663 F930L probably benign Het
Kcnh8 A G 17: 52,956,715 T747A probably benign Het
Kit A G 5: 75,645,932 E699G probably benign Het
Lamc3 T C 2: 31,921,763 S921P probably benign Het
Lrrc63 TGGCGGCGGCGGCGGCGGCGGC TGGCGGCGGCGGCGGCGGCGGCGGC 14: 75,125,221 probably benign Het
Map10 TCAGTTGTCCAG TCAG 8: 125,670,521 probably null Het
Map2k5 T C 9: 63,358,018 E76G probably damaging Het
Mgat3 G T 15: 80,211,772 E267* probably null Het
Npepps C A 11: 97,248,269 G159V probably damaging Het
Nrap A G 19: 56,335,288 V1284A probably benign Het
Olfr518 T A 7: 108,881,403 I68F probably damaging Het
Olfr792 A T 10: 129,540,693 H52L probably benign Het
Oxgr1 T C 14: 120,022,869 probably null Het
Pcdhb18 T C 18: 37,491,255 L546P possibly damaging Het
Pcdhga5 G A 18: 37,696,580 V694M probably damaging Het
Pde9a A T 17: 31,460,200 I255F possibly damaging Het
Pi4k2a G A 19: 42,090,574 G25R probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ppp1r37 A G 7: 19,534,064 I302T probably damaging Het
Prkar2a T A 9: 108,745,545 Y311N probably damaging Het
Prkd3 A T 17: 78,972,501 D254E probably benign Het
Prmt9 T C 8: 77,568,344 V439A probably benign Het
Ptpra T C 2: 130,504,206 S96P probably benign Het
Rnf103 A G 6: 71,508,930 T182A probably benign Het
Rpusd4 A G 9: 35,267,932 S15G probably benign Het
Sco1 A G 11: 67,058,393 Y229C probably damaging Het
Skint5 T A 4: 113,559,835 Q1139L unknown Het
Slc16a12 A G 19: 34,675,179 V189A probably damaging Het
Slfn8 T G 11: 83,004,255 N575T probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Stard9 T C 2: 120,700,984 L2574P probably damaging Het
Syn3 A T 10: 86,055,540 probably benign Het
Tspo2 A T 17: 48,449,957 D32E probably damaging Het
Vmn1r72 A G 7: 11,669,625 F299L probably benign Het
Wdr66 A G 5: 123,254,259 probably benign Het
Xbp1 G A 11: 5,524,886 M262I probably benign Het
Zfp354b G A 11: 50,923,805 Q98* probably null Het
Other mutations in Crb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Crb2 APN 2 37792064 missense probably damaging 1.00
IGL01357:Crb2 APN 2 37795511 unclassified probably benign
IGL01363:Crb2 APN 2 37793833 missense probably benign 0.01
IGL02006:Crb2 APN 2 37786463 missense probably damaging 1.00
IGL02380:Crb2 APN 2 37783435 missense probably damaging 0.96
IGL02455:Crb2 APN 2 37794564 missense possibly damaging 0.74
IGL03107:Crb2 APN 2 37791416 missense probably benign 0.10
R1350:Crb2 UTSW 2 37792069 missense probably damaging 1.00
R1353:Crb2 UTSW 2 37787281 missense probably damaging 1.00
R1466:Crb2 UTSW 2 37783388 missense probably damaging 1.00
R1466:Crb2 UTSW 2 37783388 missense probably damaging 1.00
R1509:Crb2 UTSW 2 37786619 missense probably benign 0.01
R1734:Crb2 UTSW 2 37793656 missense probably damaging 1.00
R2006:Crb2 UTSW 2 37783434 missense probably damaging 0.99
R2918:Crb2 UTSW 2 37783383 missense probably benign 0.01
R3431:Crb2 UTSW 2 37792217 missense probably benign 0.24
R3975:Crb2 UTSW 2 37793668 missense possibly damaging 0.74
R4074:Crb2 UTSW 2 37786843 missense probably damaging 1.00
R4518:Crb2 UTSW 2 37790389 missense probably damaging 1.00
R4521:Crb2 UTSW 2 37795337 unclassified probably benign
R4801:Crb2 UTSW 2 37793756 missense probably benign 0.09
R4802:Crb2 UTSW 2 37793756 missense probably benign 0.09
R4913:Crb2 UTSW 2 37790245 missense probably benign
R4930:Crb2 UTSW 2 37783314 missense probably damaging 1.00
R4947:Crb2 UTSW 2 37795331 unclassified probably benign
R4959:Crb2 UTSW 2 37790470 missense probably damaging 0.99
R5215:Crb2 UTSW 2 37793753 missense probably benign 0.23
R5268:Crb2 UTSW 2 37790821 missense probably damaging 1.00
R5446:Crb2 UTSW 2 37795449 missense probably benign 0.16
R5739:Crb2 UTSW 2 37793654 missense probably damaging 0.99
R5875:Crb2 UTSW 2 37787254 splice site probably null
R6179:Crb2 UTSW 2 37790257 missense probably damaging 1.00
R6450:Crb2 UTSW 2 37793826 missense possibly damaging 0.91
R6569:Crb2 UTSW 2 37792151 missense probably damaging 0.99
R6828:Crb2 UTSW 2 37776409 small deletion probably benign
R7040:Crb2 UTSW 2 37787684 missense probably benign 0.32
R7153:Crb2 UTSW 2 37787408 missense probably benign 0.00
R7362:Crb2 UTSW 2 37790199 missense probably benign 0.00
R7515:Crb2 UTSW 2 37783400 missense probably damaging 1.00
R7519:Crb2 UTSW 2 37793320 missense probably damaging 1.00
R7583:Crb2 UTSW 2 37790595 missense probably benign 0.00
R8016:Crb2 UTSW 2 37786556 missense possibly damaging 0.50
R8049:Crb2 UTSW 2 37793240 missense probably benign 0.02
R8090:Crb2 UTSW 2 37795491 missense probably damaging 1.00
X0025:Crb2 UTSW 2 37792209 missense probably damaging 1.00
Z1176:Crb2 UTSW 2 37776371 missense probably benign
Z1177:Crb2 UTSW 2 37787365 missense probably damaging 1.00
Z1177:Crb2 UTSW 2 37790824 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TTCTACCCTGATGACACCCAG -3'
(R):5'- TCGGCCAAACAGTAGCTATAG -3'

Sequencing Primer
(F):5'- CTGATGACACCCAGCTCTG -3'
(R):5'- TCAGGATGCCATCTGAGACTGATAC -3'
Posted On2019-12-03