Incidental Mutation 'R7819:D630003M21Rik'
ID601725
Institutional Source Beutler Lab
Gene Symbol D630003M21Rik
Ensembl Gene ENSMUSG00000037813
Gene NameRIKEN cDNA D630003M21 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R7819 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location158182533-158229222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 158216798 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 394 (E394G)
Ref Sequence ENSEMBL: ENSMUSP00000130623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046944] [ENSMUST00000103121] [ENSMUST00000169335]
Predicted Effect probably damaging
Transcript: ENSMUST00000046944
AA Change: E394G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040546
Gene: ENSMUSG00000037813
AA Change: E394G

DomainStartEndE-ValueType
low complexity region 321 333 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 535 N/A INTRINSIC
Blast:SEC14 567 702 1e-6 BLAST
SCOP:d1aua_2 567 711 5e-9 SMART
Blast:SPEC 712 824 3e-16 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 903 911 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1160 1174 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103121
AA Change: E394G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099410
Gene: ENSMUSG00000037813
AA Change: E394G

DomainStartEndE-ValueType
low complexity region 321 333 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 535 N/A INTRINSIC
Blast:SEC14 567 702 7e-7 BLAST
SCOP:d1aua_2 567 711 4e-9 SMART
Blast:SPEC 712 824 3e-16 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 903 911 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169335
AA Change: E394G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130623
Gene: ENSMUSG00000037813
AA Change: E394G

DomainStartEndE-ValueType
low complexity region 321 333 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 535 N/A INTRINSIC
Blast:SEC14 567 702 7e-7 BLAST
SCOP:d1aua_2 567 711 4e-9 SMART
Blast:SPEC 712 824 3e-16 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 903 911 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik C G 6: 52,179,274 probably benign Het
Abcg3 T C 5: 104,977,728 T30A probably benign Het
Adra1b A T 11: 43,835,367 V241D probably damaging Het
Ahctf1 A T 1: 179,768,315 N170K probably benign Het
Ahr A G 12: 35,510,000 L218P probably damaging Het
Apol8 C T 15: 77,749,759 V206M probably damaging Het
Arhgap11a T A 2: 113,834,918 probably null Het
B3galnt1 T C 3: 69,575,775 Y51C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C77080 A G 4: 129,222,483 V841A probably benign Het
Capn3 T C 2: 120,464,165 V98A probably benign Het
Casp12 T C 9: 5,352,805 L209P probably damaging Het
Ccdc96 A T 5: 36,485,985 Q445L probably damaging Het
Cdc37 A G 9: 21,140,964 S301P probably damaging Het
Cep89 A T 7: 35,432,543 H634L probably benign Het
Chmp3 T A 6: 71,561,024 Y12* probably null Het
Clgn A T 8: 83,408,200 I156F possibly damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
Col4a3bp A T 13: 96,629,067 T447S possibly damaging Het
Crb2 T A 2: 37,791,591 N815K probably benign Het
Csgalnact2 A C 6: 118,121,089 L97V possibly damaging Het
Ctsh T A 9: 90,060,503 M37K possibly damaging Het
Ddx31 T G 2: 28,892,451 L602R probably damaging Het
Defb40 T A 8: 18,975,034 Y52F probably benign Het
Dip2a A G 10: 76,291,028 V710A probably benign Het
Dnah2 T C 11: 69,516,593 I150V probably benign Het
Eln A T 5: 134,737,181 L56Q unknown Het
Ezh1 T C 11: 101,194,914 N639S probably damaging Het
Fzd3 A G 14: 65,235,326 F331S probably damaging Het
Gbp9 T C 5: 105,103,879 T68A possibly damaging Het
Gltp A G 5: 114,674,100 M104T probably benign Het
Gm3854 A C 7: 6,354,166 H326P probably damaging Het
Gmps G A 3: 63,985,627 V118M probably damaging Het
Gpsm1 T C 2: 26,339,693 L42P probably damaging Het
Hsfy2 T A 1: 56,636,259 H373L probably benign Het
Ica1l A T 1: 60,015,794 F93I possibly damaging Het
Idh1 A G 1: 65,165,118 S278P probably damaging Het
Ighmbp2 C T 19: 3,267,276 G532D possibly damaging Het
Ikbkb A G 8: 22,671,726 L382S probably benign Het
Il1rap T A 16: 26,722,401 M464K possibly damaging Het
Ing2 G A 8: 47,669,028 R162C probably damaging Het
Ints1 A T 5: 139,760,767 L1275H probably damaging Het
Ispd A G 12: 36,381,903 T44A probably benign Het
Itga1 T C 13: 115,049,301 E55G probably damaging Het
Itih4 T C 14: 30,901,663 F930L probably benign Het
Kcnh8 A G 17: 52,956,715 T747A probably benign Het
Kit A G 5: 75,645,932 E699G probably benign Het
Lamc3 T C 2: 31,921,763 S921P probably benign Het
Lrrc63 TGGCGGCGGCGGCGGCGGCGGC TGGCGGCGGCGGCGGCGGCGGCGGC 14: 75,125,221 probably benign Het
Map10 TCAGTTGTCCAG TCAG 8: 125,670,521 probably null Het
Map2k5 T C 9: 63,358,018 E76G probably damaging Het
Mgat3 G T 15: 80,211,772 E267* probably null Het
Npepps C A 11: 97,248,269 G159V probably damaging Het
Nrap A G 19: 56,335,288 V1284A probably benign Het
Olfr518 T A 7: 108,881,403 I68F probably damaging Het
Olfr792 A T 10: 129,540,693 H52L probably benign Het
Oxgr1 T C 14: 120,022,869 probably null Het
Pcdhb18 T C 18: 37,491,255 L546P possibly damaging Het
Pcdhga5 G A 18: 37,696,580 V694M probably damaging Het
Pde9a A T 17: 31,460,200 I255F possibly damaging Het
Pi4k2a G A 19: 42,090,574 G25R probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ppp1r37 A G 7: 19,534,064 I302T probably damaging Het
Prkar2a T A 9: 108,745,545 Y311N probably damaging Het
Prkd3 A T 17: 78,972,501 D254E probably benign Het
Prmt9 T C 8: 77,568,344 V439A probably benign Het
Ptpra T C 2: 130,504,206 S96P probably benign Het
Rnf103 A G 6: 71,508,930 T182A probably benign Het
Rpusd4 A G 9: 35,267,932 S15G probably benign Het
Sco1 A G 11: 67,058,393 Y229C probably damaging Het
Skint5 T A 4: 113,559,835 Q1139L unknown Het
Slc16a12 A G 19: 34,675,179 V189A probably damaging Het
Slfn8 T G 11: 83,004,255 N575T probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Stard9 T C 2: 120,700,984 L2574P probably damaging Het
Syn3 A T 10: 86,055,540 probably benign Het
Tspo2 A T 17: 48,449,957 D32E probably damaging Het
Vmn1r72 A G 7: 11,669,625 F299L probably benign Het
Wdr66 A G 5: 123,254,259 probably benign Het
Xbp1 G A 11: 5,524,886 M262I probably benign Het
Zfp354b G A 11: 50,923,805 Q98* probably null Het
Other mutations in D630003M21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:D630003M21Rik APN 2 158213412 missense possibly damaging 0.92
IGL01447:D630003M21Rik APN 2 158217356 missense probably benign
IGL01501:D630003M21Rik APN 2 158201067 missense probably benign 0.03
IGL01874:D630003M21Rik APN 2 158204724 missense probably damaging 1.00
IGL02116:D630003M21Rik APN 2 158203210 missense possibly damaging 0.76
IGL02212:D630003M21Rik APN 2 158210171 missense probably benign 0.02
IGL02477:D630003M21Rik APN 2 158217488 missense probably benign 0.44
IGL02644:D630003M21Rik APN 2 158216810 missense possibly damaging 0.87
IGL02861:D630003M21Rik APN 2 158200998 missense probably benign 0.03
IGL02896:D630003M21Rik APN 2 158217285 missense probably benign 0.00
IGL03089:D630003M21Rik APN 2 158216744 missense probably benign
IGL03148:D630003M21Rik APN 2 158217224 missense probably damaging 1.00
ANU05:D630003M21Rik UTSW 2 158196388 missense probably benign 0.00
ANU18:D630003M21Rik UTSW 2 158217648 missense probably benign
F5770:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
R0113:D630003M21Rik UTSW 2 158196575 missense possibly damaging 0.92
R0147:D630003M21Rik UTSW 2 158203067 splice site probably benign
R0513:D630003M21Rik UTSW 2 158200308 missense probably benign 0.44
R0637:D630003M21Rik UTSW 2 158195407 intron probably benign
R1594:D630003M21Rik UTSW 2 158211630 missense probably damaging 1.00
R1774:D630003M21Rik UTSW 2 158220470 missense probably damaging 1.00
R1823:D630003M21Rik UTSW 2 158217557 missense probably damaging 1.00
R1864:D630003M21Rik UTSW 2 158203185 missense probably damaging 1.00
R1983:D630003M21Rik UTSW 2 158208421 missense probably benign 0.34
R2042:D630003M21Rik UTSW 2 158215849 missense probably damaging 1.00
R2259:D630003M21Rik UTSW 2 158204711 missense probably damaging 1.00
R2350:D630003M21Rik UTSW 2 158201011 missense probably damaging 0.96
R3157:D630003M21Rik UTSW 2 158195472 intron probably benign
R3937:D630003M21Rik UTSW 2 158200360 missense probably damaging 1.00
R4124:D630003M21Rik UTSW 2 158196593 missense probably damaging 0.97
R4437:D630003M21Rik UTSW 2 158213462 missense probably damaging 1.00
R4473:D630003M21Rik UTSW 2 158213462 missense probably damaging 1.00
R4513:D630003M21Rik UTSW 2 158204802 missense probably benign 0.01
R4514:D630003M21Rik UTSW 2 158204802 missense probably benign 0.01
R4729:D630003M21Rik UTSW 2 158216703 missense probably damaging 1.00
R4794:D630003M21Rik UTSW 2 158196139 missense probably benign
R4947:D630003M21Rik UTSW 2 158186196 missense unknown
R5005:D630003M21Rik UTSW 2 158211643 missense possibly damaging 0.87
R5022:D630003M21Rik UTSW 2 158217633 missense probably damaging 0.99
R5167:D630003M21Rik UTSW 2 158205745 missense probably damaging 1.00
R5191:D630003M21Rik UTSW 2 158201035 missense probably benign 0.06
R5488:D630003M21Rik UTSW 2 158217021 missense probably benign 0.15
R5489:D630003M21Rik UTSW 2 158217021 missense probably benign 0.15
R5495:D630003M21Rik UTSW 2 158220511 missense possibly damaging 0.69
R5708:D630003M21Rik UTSW 2 158220392 splice site probably null
R5770:D630003M21Rik UTSW 2 158195580 intron probably benign
R5789:D630003M21Rik UTSW 2 158216814 missense possibly damaging 0.63
R5817:D630003M21Rik UTSW 2 158196493 missense probably damaging 1.00
R5898:D630003M21Rik UTSW 2 158204657 splice site probably null
R5969:D630003M21Rik UTSW 2 158217708 missense probably damaging 1.00
R6084:D630003M21Rik UTSW 2 158217584 missense probably damaging 0.99
R6111:D630003M21Rik UTSW 2 158213448 missense probably damaging 1.00
R6225:D630003M21Rik UTSW 2 158217401 missense probably benign 0.23
R6307:D630003M21Rik UTSW 2 158215951 missense probably benign 0.34
R6350:D630003M21Rik UTSW 2 158220495 missense probably damaging 1.00
R6548:D630003M21Rik UTSW 2 158205699 critical splice donor site probably null
R6583:D630003M21Rik UTSW 2 158220516 missense probably damaging 0.98
R6821:D630003M21Rik UTSW 2 158204774 missense probably damaging 1.00
R6963:D630003M21Rik UTSW 2 158200308 missense probably benign 0.44
R7021:D630003M21Rik UTSW 2 158216750 missense possibly damaging 0.59
R7210:D630003M21Rik UTSW 2 158216012 critical splice acceptor site probably null
R7345:D630003M21Rik UTSW 2 158217209 missense probably damaging 1.00
R7355:D630003M21Rik UTSW 2 158200224 missense probably damaging 1.00
R7514:D630003M21Rik UTSW 2 158217353 missense probably damaging 1.00
R7587:D630003M21Rik UTSW 2 158196388 missense probably benign 0.00
R7587:D630003M21Rik UTSW 2 158201056 missense probably damaging 1.00
R7713:D630003M21Rik UTSW 2 158216778 nonsense probably null
R7792:D630003M21Rik UTSW 2 158210162 missense possibly damaging 0.94
R7832:D630003M21Rik UTSW 2 158217668 missense probably damaging 1.00
R8115:D630003M21Rik UTSW 2 158216590 missense probably benign 0.23
V7580:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
V7581:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
V7583:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AAGCTCTCCCATGTCCTAGTG -3'
(R):5'- GCTTGGAAAGACCCTTCCTCTC -3'

Sequencing Primer
(F):5'- TCCCATGTCCTAGTGTGGTC -3'
(R):5'- ACCTCCCTTGGGAAGATGG -3'
Posted On2019-12-03