Incidental Mutation 'R7819:Skint5'
ID601728
Institutional Source Beutler Lab
Gene Symbol Skint5
Ensembl Gene ENSMUSG00000078598
Gene Nameselection and upkeep of intraepithelial T cells 5
SynonymsOTTMUSG00000008560
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R7819 (G1)
Quality Score222.009
Status Not validated
Chromosome4
Chromosomal Location113477891-113999503 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 113559835 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1139 (Q1139L)
Ref Sequence ENSEMBL: ENSMUSP00000129582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169631] [ENSMUST00000170105]
Predicted Effect unknown
Transcript: ENSMUST00000169631
AA Change: Q1139L
SMART Domains Protein: ENSMUSP00000132470
Gene: ENSMUSG00000078598
AA Change: Q1139L

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
IGv 58 139 2.48e-8 SMART
Blast:IG_like 173 249 2e-16 BLAST
internal_repeat_2 282 614 9.14e-29 PROSPERO
internal_repeat_1 284 770 2.19e-39 PROSPERO
low complexity region 772 781 N/A INTRINSIC
internal_repeat_1 808 1294 2.19e-39 PROSPERO
internal_repeat_2 995 1306 9.14e-29 PROSPERO
transmembrane domain 1322 1341 N/A INTRINSIC
transmembrane domain 1361 1383 N/A INTRINSIC
transmembrane domain 1398 1420 N/A INTRINSIC
transmembrane domain 1441 1463 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000170105
AA Change: Q1139L
SMART Domains Protein: ENSMUSP00000129582
Gene: ENSMUSG00000078598
AA Change: Q1139L

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
IGv 58 139 2.48e-8 SMART
Pfam:C2-set_2 162 238 3.9e-6 PFAM
internal_repeat_3 276 364 2.13e-10 PROSPERO
internal_repeat_2 282 593 3.81e-24 PROSPERO
internal_repeat_1 284 749 6.25e-39 PROSPERO
low complexity region 751 760 N/A INTRINSIC
low complexity region 772 781 N/A INTRINSIC
internal_repeat_1 808 1273 6.25e-39 PROSPERO
internal_repeat_2 995 1285 3.81e-24 PROSPERO
internal_repeat_3 1196 1287 2.13e-10 PROSPERO
transmembrane domain 1301 1320 N/A INTRINSIC
transmembrane domain 1340 1362 N/A INTRINSIC
transmembrane domain 1377 1399 N/A INTRINSIC
transmembrane domain 1420 1442 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik C G 6: 52,179,274 probably benign Het
Abcg3 T C 5: 104,977,728 T30A probably benign Het
Adra1b A T 11: 43,835,367 V241D probably damaging Het
Ahctf1 A T 1: 179,768,315 N170K probably benign Het
Ahr A G 12: 35,510,000 L218P probably damaging Het
Apol8 C T 15: 77,749,759 V206M probably damaging Het
Arhgap11a T A 2: 113,834,918 probably null Het
B3galnt1 T C 3: 69,575,775 Y51C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C77080 A G 4: 129,222,483 V841A probably benign Het
Capn3 T C 2: 120,464,165 V98A probably benign Het
Casp12 T C 9: 5,352,805 L209P probably damaging Het
Ccdc96 A T 5: 36,485,985 Q445L probably damaging Het
Cdc37 A G 9: 21,140,964 S301P probably damaging Het
Cep89 A T 7: 35,432,543 H634L probably benign Het
Chmp3 T A 6: 71,561,024 Y12* probably null Het
Clgn A T 8: 83,408,200 I156F possibly damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
Col4a3bp A T 13: 96,629,067 T447S possibly damaging Het
Crb2 T A 2: 37,791,591 N815K probably benign Het
Csgalnact2 A C 6: 118,121,089 L97V possibly damaging Het
Ctsh T A 9: 90,060,503 M37K possibly damaging Het
D630003M21Rik T C 2: 158,216,798 E394G probably damaging Het
Ddx31 T G 2: 28,892,451 L602R probably damaging Het
Defb40 T A 8: 18,975,034 Y52F probably benign Het
Dip2a A G 10: 76,291,028 V710A probably benign Het
Dnah2 T C 11: 69,516,593 I150V probably benign Het
Eln A T 5: 134,737,181 L56Q unknown Het
Ezh1 T C 11: 101,194,914 N639S probably damaging Het
Fzd3 A G 14: 65,235,326 F331S probably damaging Het
Gbp9 T C 5: 105,103,879 T68A possibly damaging Het
Gltp A G 5: 114,674,100 M104T probably benign Het
Gm3854 A C 7: 6,354,166 H326P probably damaging Het
Gmps G A 3: 63,985,627 V118M probably damaging Het
Gpsm1 T C 2: 26,339,693 L42P probably damaging Het
Hsfy2 T A 1: 56,636,259 H373L probably benign Het
Ica1l A T 1: 60,015,794 F93I possibly damaging Het
Idh1 A G 1: 65,165,118 S278P probably damaging Het
Ighmbp2 C T 19: 3,267,276 G532D possibly damaging Het
Ikbkb A G 8: 22,671,726 L382S probably benign Het
Il1rap T A 16: 26,722,401 M464K possibly damaging Het
Ing2 G A 8: 47,669,028 R162C probably damaging Het
Ints1 A T 5: 139,760,767 L1275H probably damaging Het
Ispd A G 12: 36,381,903 T44A probably benign Het
Itga1 T C 13: 115,049,301 E55G probably damaging Het
Itih4 T C 14: 30,901,663 F930L probably benign Het
Kcnh8 A G 17: 52,956,715 T747A probably benign Het
Kit A G 5: 75,645,932 E699G probably benign Het
Lamc3 T C 2: 31,921,763 S921P probably benign Het
Lrrc63 TGGCGGCGGCGGCGGCGGCGGC TGGCGGCGGCGGCGGCGGCGGCGGC 14: 75,125,221 probably benign Het
Map10 TCAGTTGTCCAG TCAG 8: 125,670,521 probably null Het
Map2k5 T C 9: 63,358,018 E76G probably damaging Het
Mgat3 G T 15: 80,211,772 E267* probably null Het
Npepps C A 11: 97,248,269 G159V probably damaging Het
Nrap A G 19: 56,335,288 V1284A probably benign Het
Olfr518 T A 7: 108,881,403 I68F probably damaging Het
Olfr792 A T 10: 129,540,693 H52L probably benign Het
Oxgr1 T C 14: 120,022,869 probably null Het
Pcdhb18 T C 18: 37,491,255 L546P possibly damaging Het
Pcdhga5 G A 18: 37,696,580 V694M probably damaging Het
Pde9a A T 17: 31,460,200 I255F possibly damaging Het
Pi4k2a G A 19: 42,090,574 G25R probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ppp1r37 A G 7: 19,534,064 I302T probably damaging Het
Prkar2a T A 9: 108,745,545 Y311N probably damaging Het
Prkd3 A T 17: 78,972,501 D254E probably benign Het
Prmt9 T C 8: 77,568,344 V439A probably benign Het
Ptpra T C 2: 130,504,206 S96P probably benign Het
Rnf103 A G 6: 71,508,930 T182A probably benign Het
Rpusd4 A G 9: 35,267,932 S15G probably benign Het
Sco1 A G 11: 67,058,393 Y229C probably damaging Het
Slc16a12 A G 19: 34,675,179 V189A probably damaging Het
Slfn8 T G 11: 83,004,255 N575T probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Stard9 T C 2: 120,700,984 L2574P probably damaging Het
Syn3 A T 10: 86,055,540 probably benign Het
Tspo2 A T 17: 48,449,957 D32E probably damaging Het
Vmn1r72 A G 7: 11,669,625 F299L probably benign Het
Wdr66 A G 5: 123,254,259 probably benign Het
Xbp1 G A 11: 5,524,886 M262I probably benign Het
Zfp354b G A 11: 50,923,805 Q98* probably null Het
Other mutations in Skint5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Skint5 APN 4 113542873 critical splice donor site probably null
IGL01288:Skint5 APN 4 113524135 intron probably benign
IGL01313:Skint5 APN 4 113805164 missense unknown
IGL01446:Skint5 APN 4 113942822 missense probably damaging 1.00
IGL01861:Skint5 APN 4 113559824 splice site probably benign
IGL01955:Skint5 APN 4 113623736 critical splice donor site probably null
IGL02150:Skint5 APN 4 113885791 missense unknown
IGL02190:Skint5 APN 4 113940765 missense possibly damaging 0.93
IGL02271:Skint5 APN 4 113937581 splice site probably null
IGL02426:Skint5 APN 4 113940784 missense probably benign 0.08
IGL02484:Skint5 APN 4 113942553 nonsense probably null
IGL02548:Skint5 APN 4 113731076 missense unknown
IGL02556:Skint5 APN 4 113940735 missense probably damaging 0.99
IGL02674:Skint5 APN 4 113630385 splice site probably benign
IGL02697:Skint5 APN 4 113479713 missense probably benign 0.23
IGL02710:Skint5 APN 4 113477959 missense unknown
IGL02721:Skint5 APN 4 113942549 missense probably damaging 0.96
IGL02750:Skint5 APN 4 113539362 missense unknown
IGL03121:Skint5 APN 4 113717087 missense unknown
IGL03167:Skint5 APN 4 113893850 missense unknown
IGL03247:Skint5 APN 4 113940808 missense probably damaging 1.00
IGL03264:Skint5 APN 4 113486657 missense unknown
IGL03281:Skint5 APN 4 113667218 missense unknown
IGL03353:Skint5 APN 4 113742182 missense unknown
IGL03377:Skint5 APN 4 113763538 missense unknown
PIT4377001:Skint5 UTSW 4 113597703 missense unknown
R0006:Skint5 UTSW 4 113893862 splice site probably benign
R0026:Skint5 UTSW 4 113546468 splice site probably benign
R0096:Skint5 UTSW 4 113597768 splice site probably benign
R0096:Skint5 UTSW 4 113597768 splice site probably benign
R0277:Skint5 UTSW 4 113937621 missense probably benign 0.04
R0323:Skint5 UTSW 4 113937621 missense probably benign 0.04
R0369:Skint5 UTSW 4 113512023 critical splice donor site probably null
R0375:Skint5 UTSW 4 113705596 missense unknown
R0464:Skint5 UTSW 4 113535731 missense unknown
R0479:Skint5 UTSW 4 113655672 missense unknown
R0507:Skint5 UTSW 4 113567930 splice site probably null
R0533:Skint5 UTSW 4 113827867 missense unknown
R0628:Skint5 UTSW 4 113731069 nonsense probably null
R0645:Skint5 UTSW 4 113763482 missense unknown
R1201:Skint5 UTSW 4 113556145 missense unknown
R1240:Skint5 UTSW 4 113717107 missense unknown
R1270:Skint5 UTSW 4 113942659 nonsense probably null
R1390:Skint5 UTSW 4 113655684 missense unknown
R1398:Skint5 UTSW 4 113779071 missense unknown
R1438:Skint5 UTSW 4 113556111 splice site probably benign
R1591:Skint5 UTSW 4 113999454 critical splice donor site probably null
R1631:Skint5 UTSW 4 113483926 missense probably benign 0.23
R1653:Skint5 UTSW 4 113490678 missense unknown
R1722:Skint5 UTSW 4 113846311 splice site probably null
R1735:Skint5 UTSW 4 113563459 missense unknown
R1765:Skint5 UTSW 4 113577661 missense unknown
R2054:Skint5 UTSW 4 113819163 critical splice donor site probably null
R2058:Skint5 UTSW 4 113870700 missense possibly damaging 0.53
R2197:Skint5 UTSW 4 113940849 missense probably damaging 1.00
R2239:Skint5 UTSW 4 113546536 missense unknown
R2380:Skint5 UTSW 4 113546536 missense unknown
R2406:Skint5 UTSW 4 113942667 missense probably damaging 0.97
R2512:Skint5 UTSW 4 113630419 missense unknown
R2913:Skint5 UTSW 4 113524092 intron probably benign
R3522:Skint5 UTSW 4 113756905 critical splice donor site probably null
R3779:Skint5 UTSW 4 113779040 splice site probably benign
R3815:Skint5 UTSW 4 113629122 splice site probably benign
R3815:Skint5 UTSW 4 113846299 missense possibly damaging 0.86
R3816:Skint5 UTSW 4 113629122 splice site probably benign
R3817:Skint5 UTSW 4 113629122 splice site probably benign
R3818:Skint5 UTSW 4 113629122 splice site probably benign
R3837:Skint5 UTSW 4 113940741 missense probably damaging 1.00
R3943:Skint5 UTSW 4 113942753 missense probably damaging 1.00
R3944:Skint5 UTSW 4 113942753 missense probably damaging 1.00
R4037:Skint5 UTSW 4 113885814 missense unknown
R4038:Skint5 UTSW 4 113885814 missense unknown
R4039:Skint5 UTSW 4 113885814 missense unknown
R4280:Skint5 UTSW 4 113942552 missense probably damaging 1.00
R4308:Skint5 UTSW 4 113483967 missense unknown
R4386:Skint5 UTSW 4 113483893 missense probably benign 0.23
R4513:Skint5 UTSW 4 113742185 missense unknown
R4575:Skint5 UTSW 4 113667193 missense unknown
R4631:Skint5 UTSW 4 113629117 critical splice acceptor site probably null
R4722:Skint5 UTSW 4 113893855 missense unknown
R4854:Skint5 UTSW 4 113580528 missense unknown
R5010:Skint5 UTSW 4 113546537 missense unknown
R5070:Skint5 UTSW 4 113795538 missense unknown
R5158:Skint5 UTSW 4 113742212 missense unknown
R5163:Skint5 UTSW 4 113795565 missense unknown
R5190:Skint5 UTSW 4 113763514 missense unknown
R5232:Skint5 UTSW 4 113577644 missense unknown
R5257:Skint5 UTSW 4 113577662 missense unknown
R5499:Skint5 UTSW 4 113942503 critical splice donor site probably null
R5569:Skint5 UTSW 4 113688706 critical splice acceptor site probably null
R5776:Skint5 UTSW 4 113763503 missense unknown
R5986:Skint5 UTSW 4 113995648 missense probably benign 0.11
R5987:Skint5 UTSW 4 113885808 missense unknown
R5995:Skint5 UTSW 4 113893832 missense unknown
R6063:Skint5 UTSW 4 113490645 missense probably benign 0.23
R6074:Skint5 UTSW 4 113805200 missense unknown
R6111:Skint5 UTSW 4 113705648 missense unknown
R6173:Skint5 UTSW 4 113535710 missense unknown
R6238:Skint5 UTSW 4 113942867 splice site probably null
R6248:Skint5 UTSW 4 113779089 missense unknown
R6318:Skint5 UTSW 4 113517133 missense unknown
R6370:Skint5 UTSW 4 113614110 missense unknown
R6404:Skint5 UTSW 4 113942609 missense probably damaging 0.97
R6499:Skint5 UTSW 4 113539355 missense unknown
R6646:Skint5 UTSW 4 113940777 missense possibly damaging 0.94
R6737:Skint5 UTSW 4 113535739 missense unknown
R6795:Skint5 UTSW 4 113667223 missense unknown
R6815:Skint5 UTSW 4 113717127 critical splice acceptor site probably null
R6935:Skint5 UTSW 4 113942596 missense possibly damaging 0.56
R7028:Skint5 UTSW 4 113940839 missense probably damaging 1.00
R7043:Skint5 UTSW 4 113717107 missense unknown
R7071:Skint5 UTSW 4 113779080 missense unknown
R7142:Skint5 UTSW 4 113571594 missense unknown
R7197:Skint5 UTSW 4 113580482 critical splice donor site probably null
R7208:Skint5 UTSW 4 113539339 missense unknown
R7297:Skint5 UTSW 4 113542934 missense unknown
R7470:Skint5 UTSW 4 113756931 missense unknown
R7470:Skint5 UTSW 4 113885803 missense unknown
R7500:Skint5 UTSW 4 113559838 missense unknown
R7547:Skint5 UTSW 4 113626588 missense unknown
R7556:Skint5 UTSW 4 113567965 missense unknown
R7619:Skint5 UTSW 4 113524108 missense unknown
R7629:Skint5 UTSW 4 113942660 missense probably damaging 1.00
R7646:Skint5 UTSW 4 113763542 critical splice acceptor site probably null
R7725:Skint5 UTSW 4 113827902 missense unknown
R7788:Skint5 UTSW 4 113546518 missense unknown
R7818:Skint5 UTSW 4 113942726 missense possibly damaging 0.56
X0028:Skint5 UTSW 4 113691109 missense unknown
Predicted Primers PCR Primer
(F):5'- CCTTTTAATGGGTCACACTGAATTC -3'
(R):5'- TCTCAGCTTGAAAGAATAAACAGGC -3'

Sequencing Primer
(F):5'- ACATAACATCCTGTTTTTACCACGTG -3'
(R):5'- ATCTAATGCATGCTACTGATGGC -3'
Posted On2019-12-03