Incidental Mutation 'R7819:Map10'
ID 601754
Institutional Source Beutler Lab
Gene Symbol Map10
Ensembl Gene ENSMUSG00000050930
Gene Name microtubule-associated protein 10
Synonyms 4933403G14Rik
MMRRC Submission 045873-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R7819 (G1)
Quality Score 217.468
Status Not validated
Chromosome 8
Chromosomal Location 126396557-126400098 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) TCAGTTGTCCAG to TCAG at 126397260 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000061679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053078]
AlphaFold Q8BJS7
Predicted Effect probably null
Transcript: ENSMUST00000053078
SMART Domains Protein: ENSMUSP00000061679
Gene: ENSMUSG00000050930

DomainStartEndE-ValueType
low complexity region 38 54 N/A INTRINSIC
low complexity region 68 91 N/A INTRINSIC
Pfam:HPHLAWLY 243 535 1.4e-130 PFAM
Pfam:HPHLAWLY 527 890 9.1e-133 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik C G 6: 52,156,254 (GRCm39) probably benign Het
Abcg3 T C 5: 105,125,594 (GRCm39) T30A probably benign Het
Adra1b A T 11: 43,726,194 (GRCm39) V241D probably damaging Het
Ahctf1 A T 1: 179,595,880 (GRCm39) N170K probably benign Het
Ahr A G 12: 35,559,999 (GRCm39) L218P probably damaging Het
Apol8 C T 15: 77,633,959 (GRCm39) V206M probably damaging Het
Arhgap11a T A 2: 113,665,263 (GRCm39) probably null Het
B3galnt1 T C 3: 69,483,108 (GRCm39) Y51C probably damaging Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Capn3 T C 2: 120,294,646 (GRCm39) V98A probably benign Het
Casp12 T C 9: 5,352,805 (GRCm39) L209P probably damaging Het
Ccdc96 A T 5: 36,643,329 (GRCm39) Q445L probably damaging Het
Cdc37 A G 9: 21,052,260 (GRCm39) S301P probably damaging Het
Cep89 A T 7: 35,131,968 (GRCm39) H634L probably benign Het
Cert1 A T 13: 96,765,575 (GRCm39) T447S possibly damaging Het
Cfap251 A G 5: 123,392,322 (GRCm39) probably benign Het
Chmp3 T A 6: 71,538,008 (GRCm39) Y12* probably null Het
Clgn A T 8: 84,134,829 (GRCm39) I156F possibly damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 105,036,334 (GRCm39) probably null Het
Crb2 T A 2: 37,681,603 (GRCm39) N815K probably benign Het
Crppa A G 12: 36,431,902 (GRCm39) T44A probably benign Het
Csgalnact2 A C 6: 118,098,050 (GRCm39) L97V possibly damaging Het
Ctsh T A 9: 89,942,556 (GRCm39) M37K possibly damaging Het
D630003M21Rik T C 2: 158,058,718 (GRCm39) E394G probably damaging Het
Ddx31 T G 2: 28,782,463 (GRCm39) L602R probably damaging Het
Defb40 T A 8: 19,025,050 (GRCm39) Y52F probably benign Het
Dip2a A G 10: 76,126,862 (GRCm39) V710A probably benign Het
Dnah2 T C 11: 69,407,419 (GRCm39) I150V probably benign Het
Eln A T 5: 134,766,035 (GRCm39) L56Q unknown Het
Ezh1 T C 11: 101,085,740 (GRCm39) N639S probably damaging Het
Fzd3 A G 14: 65,472,775 (GRCm39) F331S probably damaging Het
Gbp9 T C 5: 105,251,745 (GRCm39) T68A possibly damaging Het
Gltp A G 5: 114,812,161 (GRCm39) M104T probably benign Het
Gmps G A 3: 63,893,048 (GRCm39) V118M probably damaging Het
Gpsm1 T C 2: 26,229,705 (GRCm39) L42P probably damaging Het
Hsfy2 T A 1: 56,675,418 (GRCm39) H373L probably benign Het
Ica1l A T 1: 60,054,953 (GRCm39) F93I possibly damaging Het
Idh1 A G 1: 65,204,277 (GRCm39) S278P probably damaging Het
Ighmbp2 C T 19: 3,317,276 (GRCm39) G532D possibly damaging Het
Ikbkb A G 8: 23,161,742 (GRCm39) L382S probably benign Het
Il1rap T A 16: 26,541,151 (GRCm39) M464K possibly damaging Het
Ing2 G A 8: 48,122,063 (GRCm39) R162C probably damaging Het
Ints1 A T 5: 139,746,522 (GRCm39) L1275H probably damaging Het
Itga1 T C 13: 115,185,837 (GRCm39) E55G probably damaging Het
Itih4 T C 14: 30,623,620 (GRCm39) F930L probably benign Het
Kcnh8 A G 17: 53,263,743 (GRCm39) T747A probably benign Het
Kit A G 5: 75,806,592 (GRCm39) E699G probably benign Het
Lamc3 T C 2: 31,811,775 (GRCm39) S921P probably benign Het
Lrrc63 TGGCGGCGGCGGCGGCGGCGGC TGGCGGCGGCGGCGGCGGCGGCGGC 14: 75,362,661 (GRCm39) probably benign Het
Map2k5 T C 9: 63,265,300 (GRCm39) E76G probably damaging Het
Mgat3 G T 15: 80,095,973 (GRCm39) E267* probably null Het
Nhsl3 A G 4: 129,116,276 (GRCm39) V841A probably benign Het
Npepps C A 11: 97,139,095 (GRCm39) G159V probably damaging Het
Nrap A G 19: 56,323,720 (GRCm39) V1284A probably benign Het
Or10a3 T A 7: 108,480,610 (GRCm39) I68F probably damaging Het
Or6c66b A T 10: 129,376,562 (GRCm39) H52L probably benign Het
Oxgr1 T C 14: 120,260,281 (GRCm39) probably null Het
Pcdhb18 T C 18: 37,624,308 (GRCm39) L546P possibly damaging Het
Pcdhga5 G A 18: 37,829,633 (GRCm39) V694M probably damaging Het
Pde9a A T 17: 31,679,174 (GRCm39) I255F possibly damaging Het
Pi4k2a G A 19: 42,079,013 (GRCm39) G25R probably benign Het
Plscr4 C T 9: 92,372,843 (GRCm39) R322* probably null Het
Ppp1r37 A G 7: 19,267,989 (GRCm39) I302T probably damaging Het
Prkar2a T A 9: 108,622,744 (GRCm39) Y311N probably damaging Het
Prkd3 A T 17: 79,279,930 (GRCm39) D254E probably benign Het
Prmt9 T C 8: 78,294,973 (GRCm39) V439A probably benign Het
Ptpra T C 2: 130,346,126 (GRCm39) S96P probably benign Het
Rnf103 A G 6: 71,485,914 (GRCm39) T182A probably benign Het
Rpusd4 A G 9: 35,179,228 (GRCm39) S15G probably benign Het
Sco1 A G 11: 66,949,219 (GRCm39) Y229C probably damaging Het
Skint5 T A 4: 113,417,032 (GRCm39) Q1139L unknown Het
Slc16a12 A G 19: 34,652,579 (GRCm39) V189A probably damaging Het
Slfn8 T G 11: 82,895,081 (GRCm39) N575T probably damaging Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Stard9 T C 2: 120,531,465 (GRCm39) L2574P probably damaging Het
Syn3 A T 10: 85,891,404 (GRCm39) probably benign Het
Tspo2 A T 17: 48,756,985 (GRCm39) D32E probably damaging Het
Vmn1r72 A G 7: 11,403,552 (GRCm39) F299L probably benign Het
Xbp1 G A 11: 5,474,886 (GRCm39) M262I probably benign Het
Zfp354b G A 11: 50,814,632 (GRCm39) Q98* probably null Het
Zfp582 A C 7: 6,357,165 (GRCm39) H326P probably damaging Het
Other mutations in Map10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Map10 APN 8 126,398,671 (GRCm39) missense probably benign 0.00
IGL01567:Map10 APN 8 126,398,232 (GRCm39) missense probably benign 0.32
IGL02566:Map10 APN 8 126,398,494 (GRCm39) missense probably benign
IGL03088:Map10 APN 8 126,397,809 (GRCm39) missense probably benign 0.14
debauched UTSW 8 126,397,984 (GRCm39) missense probably damaging 1.00
R1083:Map10 UTSW 8 126,397,178 (GRCm39) nonsense probably null
R1543:Map10 UTSW 8 126,397,611 (GRCm39) missense probably benign 0.00
R3155:Map10 UTSW 8 126,398,313 (GRCm39) missense possibly damaging 0.79
R4076:Map10 UTSW 8 126,398,584 (GRCm39) missense probably benign 0.23
R4559:Map10 UTSW 8 126,398,553 (GRCm39) missense probably benign
R4856:Map10 UTSW 8 126,397,431 (GRCm39) missense probably damaging 1.00
R4886:Map10 UTSW 8 126,397,431 (GRCm39) missense probably damaging 1.00
R5412:Map10 UTSW 8 126,397,724 (GRCm39) missense probably damaging 1.00
R6034:Map10 UTSW 8 126,399,205 (GRCm39) missense probably damaging 1.00
R6034:Map10 UTSW 8 126,399,205 (GRCm39) missense probably damaging 1.00
R6150:Map10 UTSW 8 126,398,328 (GRCm39) missense probably damaging 0.96
R6351:Map10 UTSW 8 126,397,984 (GRCm39) missense probably damaging 1.00
R6466:Map10 UTSW 8 126,399,123 (GRCm39) nonsense probably null
R6544:Map10 UTSW 8 126,398,113 (GRCm39) missense probably benign 0.00
R6557:Map10 UTSW 8 126,396,991 (GRCm39) missense probably damaging 0.98
R6821:Map10 UTSW 8 126,397,138 (GRCm39) missense probably benign 0.01
R7096:Map10 UTSW 8 126,398,662 (GRCm39) missense probably damaging 0.99
R7128:Map10 UTSW 8 126,398,592 (GRCm39) missense probably benign
R7177:Map10 UTSW 8 126,398,584 (GRCm39) missense probably benign 0.23
R7237:Map10 UTSW 8 126,397,963 (GRCm39) missense probably benign 0.03
R7814:Map10 UTSW 8 126,398,350 (GRCm39) missense probably benign 0.14
R8202:Map10 UTSW 8 126,397,647 (GRCm39) missense possibly damaging 0.95
R8812:Map10 UTSW 8 126,396,664 (GRCm39) missense probably damaging 0.99
R8859:Map10 UTSW 8 126,397,291 (GRCm39) missense probably benign 0.04
R8947:Map10 UTSW 8 126,397,839 (GRCm39) missense probably benign 0.06
R9178:Map10 UTSW 8 126,397,649 (GRCm39) missense probably damaging 0.98
R9698:Map10 UTSW 8 126,398,723 (GRCm39) missense probably benign 0.16
Z1088:Map10 UTSW 8 126,398,670 (GRCm39) frame shift probably null
Z1177:Map10 UTSW 8 126,396,809 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCCCTGCTTGTATCCTG -3'
(R):5'- GCTGAAGGAGTCTTTTCCTGAGTC -3'

Sequencing Primer
(F):5'- GCTTGTATCCTGGACTCCGAAG -3'
(R):5'- CCTGAGTCAGGTGAGTGTAATAC -3'
Posted On 2019-12-03