Incidental Mutation 'R7819:Rpusd4'
ID601757
Institutional Source Beutler Lab
Gene Symbol Rpusd4
Ensembl Gene ENSMUSG00000032044
Gene NameRNA pseudouridylate synthase domain containing 4
Synonyms2410001E19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R7819 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location35267865-35277731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35267932 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 15 (S15G)
Ref Sequence ENSEMBL: ENSMUSP00000034543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034543] [ENSMUST00000059057] [ENSMUST00000063782] [ENSMUST00000121564] [ENSMUST00000125087] [ENSMUST00000217306]
Predicted Effect probably benign
Transcript: ENSMUST00000034543
AA Change: S15G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034543
Gene: ENSMUSG00000032044
AA Change: S15G

DomainStartEndE-ValueType
Pfam:PseudoU_synth_2 105 277 5.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059057
SMART Domains Protein: ENSMUSP00000058377
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
low complexity region 71 86 N/A INTRINSIC
Pfam:SIR2_2 157 301 1.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063782
SMART Domains Protein: ENSMUSP00000066281
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
Pfam:SIR2_2 75 225 7.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121564
SMART Domains Protein: ENSMUSP00000113537
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
low complexity region 71 86 N/A INTRINSIC
Pfam:SIR2_2 157 301 2.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125087
SMART Domains Protein: ENSMUSP00000119747
Gene: ENSMUSG00000050471

DomainStartEndE-ValueType
low complexity region 71 86 N/A INTRINSIC
Pfam:SIR2_2 157 268 3.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217306
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik C G 6: 52,179,274 probably benign Het
Abcg3 T C 5: 104,977,728 T30A probably benign Het
Adra1b A T 11: 43,835,367 V241D probably damaging Het
Ahctf1 A T 1: 179,768,315 N170K probably benign Het
Ahr A G 12: 35,510,000 L218P probably damaging Het
Apol8 C T 15: 77,749,759 V206M probably damaging Het
Arhgap11a T A 2: 113,834,918 probably null Het
B3galnt1 T C 3: 69,575,775 Y51C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C77080 A G 4: 129,222,483 V841A probably benign Het
Capn3 T C 2: 120,464,165 V98A probably benign Het
Casp12 T C 9: 5,352,805 L209P probably damaging Het
Ccdc96 A T 5: 36,485,985 Q445L probably damaging Het
Cdc37 A G 9: 21,140,964 S301P probably damaging Het
Cep89 A T 7: 35,432,543 H634L probably benign Het
Chmp3 T A 6: 71,561,024 Y12* probably null Het
Clgn A T 8: 83,408,200 I156F possibly damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
Col4a3bp A T 13: 96,629,067 T447S possibly damaging Het
Crb2 T A 2: 37,791,591 N815K probably benign Het
Csgalnact2 A C 6: 118,121,089 L97V possibly damaging Het
Ctsh T A 9: 90,060,503 M37K possibly damaging Het
D630003M21Rik T C 2: 158,216,798 E394G probably damaging Het
Ddx31 T G 2: 28,892,451 L602R probably damaging Het
Defb40 T A 8: 18,975,034 Y52F probably benign Het
Dip2a A G 10: 76,291,028 V710A probably benign Het
Dnah2 T C 11: 69,516,593 I150V probably benign Het
Eln A T 5: 134,737,181 L56Q unknown Het
Ezh1 T C 11: 101,194,914 N639S probably damaging Het
Fzd3 A G 14: 65,235,326 F331S probably damaging Het
Gbp9 T C 5: 105,103,879 T68A possibly damaging Het
Gltp A G 5: 114,674,100 M104T probably benign Het
Gm3854 A C 7: 6,354,166 H326P probably damaging Het
Gmps G A 3: 63,985,627 V118M probably damaging Het
Gpsm1 T C 2: 26,339,693 L42P probably damaging Het
Hsfy2 T A 1: 56,636,259 H373L probably benign Het
Ica1l A T 1: 60,015,794 F93I possibly damaging Het
Idh1 A G 1: 65,165,118 S278P probably damaging Het
Ighmbp2 C T 19: 3,267,276 G532D possibly damaging Het
Ikbkb A G 8: 22,671,726 L382S probably benign Het
Il1rap T A 16: 26,722,401 M464K possibly damaging Het
Ing2 G A 8: 47,669,028 R162C probably damaging Het
Ints1 A T 5: 139,760,767 L1275H probably damaging Het
Ispd A G 12: 36,381,903 T44A probably benign Het
Itga1 T C 13: 115,049,301 E55G probably damaging Het
Itih4 T C 14: 30,901,663 F930L probably benign Het
Kcnh8 A G 17: 52,956,715 T747A probably benign Het
Kit A G 5: 75,645,932 E699G probably benign Het
Lamc3 T C 2: 31,921,763 S921P probably benign Het
Lrrc63 TGGCGGCGGCGGCGGCGGCGGC TGGCGGCGGCGGCGGCGGCGGCGGC 14: 75,125,221 probably benign Het
Map10 TCAGTTGTCCAG TCAG 8: 125,670,521 probably null Het
Map2k5 T C 9: 63,358,018 E76G probably damaging Het
Mgat3 G T 15: 80,211,772 E267* probably null Het
Npepps C A 11: 97,248,269 G159V probably damaging Het
Nrap A G 19: 56,335,288 V1284A probably benign Het
Olfr518 T A 7: 108,881,403 I68F probably damaging Het
Olfr792 A T 10: 129,540,693 H52L probably benign Het
Oxgr1 T C 14: 120,022,869 probably null Het
Pcdhb18 T C 18: 37,491,255 L546P possibly damaging Het
Pcdhga5 G A 18: 37,696,580 V694M probably damaging Het
Pde9a A T 17: 31,460,200 I255F possibly damaging Het
Pi4k2a G A 19: 42,090,574 G25R probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ppp1r37 A G 7: 19,534,064 I302T probably damaging Het
Prkar2a T A 9: 108,745,545 Y311N probably damaging Het
Prkd3 A T 17: 78,972,501 D254E probably benign Het
Prmt9 T C 8: 77,568,344 V439A probably benign Het
Ptpra T C 2: 130,504,206 S96P probably benign Het
Rnf103 A G 6: 71,508,930 T182A probably benign Het
Sco1 A G 11: 67,058,393 Y229C probably damaging Het
Skint5 T A 4: 113,559,835 Q1139L unknown Het
Slc16a12 A G 19: 34,675,179 V189A probably damaging Het
Slfn8 T G 11: 83,004,255 N575T probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Stard9 T C 2: 120,700,984 L2574P probably damaging Het
Syn3 A T 10: 86,055,540 probably benign Het
Tspo2 A T 17: 48,449,957 D32E probably damaging Het
Vmn1r72 A G 7: 11,669,625 F299L probably benign Het
Wdr66 A G 5: 123,254,259 probably benign Het
Xbp1 G A 11: 5,524,886 M262I probably benign Het
Zfp354b G A 11: 50,923,805 Q98* probably null Het
Other mutations in Rpusd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Rpusd4 APN 9 35268442 missense probably benign 0.34
IGL00722:Rpusd4 APN 9 35268418 missense possibly damaging 0.66
IGL01657:Rpusd4 APN 9 35273461 unclassified probably benign
IGL01780:Rpusd4 APN 9 35268424 missense probably damaging 0.98
IGL03290:Rpusd4 APN 9 35267977 missense probably benign
R0607:Rpusd4 UTSW 9 35267993 missense possibly damaging 0.93
R1081:Rpusd4 UTSW 9 35275088 missense probably benign 0.04
R1441:Rpusd4 UTSW 9 35272769 missense probably damaging 0.97
R2029:Rpusd4 UTSW 9 35268014 missense probably benign 0.00
R3929:Rpusd4 UTSW 9 35272580 missense probably benign 0.29
R4107:Rpusd4 UTSW 9 35275128 missense probably damaging 1.00
R4840:Rpusd4 UTSW 9 35268535 missense probably damaging 1.00
R5429:Rpusd4 UTSW 9 35272602 missense probably benign 0.01
R5801:Rpusd4 UTSW 9 35270073 missense possibly damaging 0.83
R5988:Rpusd4 UTSW 9 35272520 splice site probably null
R6318:Rpusd4 UTSW 9 35268038 missense probably damaging 1.00
R7995:Rpusd4 UTSW 9 35272721 missense probably damaging 0.99
R8227:Rpusd4 UTSW 9 35268535 missense probably benign 0.22
R8246:Rpusd4 UTSW 9 35272580 missense probably benign 0.29
V1662:Rpusd4 UTSW 9 35272761 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGCAGTGCTCTCCAAGAATG -3'
(R):5'- CTTCTCGGAAGTTGAGTCTCTC -3'

Sequencing Primer
(F):5'- GCCATGCGAAAACCGTTG -3'
(R):5'- TCTCTAGACTCACCCGCAC -3'
Posted On2019-12-03