Incidental Mutation 'R7819:Slfn8'
ID601770
Institutional Source Beutler Lab
Gene Symbol Slfn8
Ensembl Gene ENSMUSG00000035208
Gene Nameschlafen 8
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7819 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location83002158-83020810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 83004255 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 575 (N575T)
Ref Sequence ENSEMBL: ENSMUSP00000114417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038141] [ENSMUST00000092838] [ENSMUST00000108152] [ENSMUST00000130822] [ENSMUST00000215239]
Predicted Effect probably damaging
Transcript: ENSMUST00000038141
AA Change: N575T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040060
Gene: ENSMUSG00000035208
AA Change: N575T

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 1.6e-18 PFAM
Pfam:DUF2075 592 766 5.8e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092838
AA Change: N575T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090513
Gene: ENSMUSG00000035208
AA Change: N575T

DomainStartEndE-ValueType
Pfam:AlbA_2 205 341 1.4e-17 PFAM
Pfam:DUF2075 592 767 2.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108152
SMART Domains Protein: ENSMUSP00000103787
Gene: ENSMUSG00000035208

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 4.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130822
AA Change: N575T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114417
Gene: ENSMUSG00000035208
AA Change: N575T

DomainStartEndE-ValueType
Pfam:AAA_4 205 343 3.7e-19 PFAM
SCOP:d1ly1a_ 593 625 4e-3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000121831
Gene: ENSMUSG00000035208
AA Change: N351T

DomainStartEndE-ValueType
Pfam:AlbA_2 27 163 1.8e-15 PFAM
SCOP:d1ly1a_ 370 402 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000215239
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik C G 6: 52,179,274 probably benign Het
Abcg3 T C 5: 104,977,728 T30A probably benign Het
Adra1b A T 11: 43,835,367 V241D probably damaging Het
Ahctf1 A T 1: 179,768,315 N170K probably benign Het
Ahr A G 12: 35,510,000 L218P probably damaging Het
Apol8 C T 15: 77,749,759 V206M probably damaging Het
Arhgap11a T A 2: 113,834,918 probably null Het
B3galnt1 T C 3: 69,575,775 Y51C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C77080 A G 4: 129,222,483 V841A probably benign Het
Capn3 T C 2: 120,464,165 V98A probably benign Het
Casp12 T C 9: 5,352,805 L209P probably damaging Het
Ccdc96 A T 5: 36,485,985 Q445L probably damaging Het
Cdc37 A G 9: 21,140,964 S301P probably damaging Het
Cep89 A T 7: 35,432,543 H634L probably benign Het
Chmp3 T A 6: 71,561,024 Y12* probably null Het
Clgn A T 8: 83,408,200 I156F possibly damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
Col4a3bp A T 13: 96,629,067 T447S possibly damaging Het
Crb2 T A 2: 37,791,591 N815K probably benign Het
Csgalnact2 A C 6: 118,121,089 L97V possibly damaging Het
Ctsh T A 9: 90,060,503 M37K possibly damaging Het
D630003M21Rik T C 2: 158,216,798 E394G probably damaging Het
Ddx31 T G 2: 28,892,451 L602R probably damaging Het
Defb40 T A 8: 18,975,034 Y52F probably benign Het
Dip2a A G 10: 76,291,028 V710A probably benign Het
Dnah2 T C 11: 69,516,593 I150V probably benign Het
Eln A T 5: 134,737,181 L56Q unknown Het
Ezh1 T C 11: 101,194,914 N639S probably damaging Het
Fzd3 A G 14: 65,235,326 F331S probably damaging Het
Gbp9 T C 5: 105,103,879 T68A possibly damaging Het
Gltp A G 5: 114,674,100 M104T probably benign Het
Gm3854 A C 7: 6,354,166 H326P probably damaging Het
Gmps G A 3: 63,985,627 V118M probably damaging Het
Gpsm1 T C 2: 26,339,693 L42P probably damaging Het
Hsfy2 T A 1: 56,636,259 H373L probably benign Het
Ica1l A T 1: 60,015,794 F93I possibly damaging Het
Idh1 A G 1: 65,165,118 S278P probably damaging Het
Ighmbp2 C T 19: 3,267,276 G532D possibly damaging Het
Ikbkb A G 8: 22,671,726 L382S probably benign Het
Il1rap T A 16: 26,722,401 M464K possibly damaging Het
Ing2 G A 8: 47,669,028 R162C probably damaging Het
Ints1 A T 5: 139,760,767 L1275H probably damaging Het
Ispd A G 12: 36,381,903 T44A probably benign Het
Itga1 T C 13: 115,049,301 E55G probably damaging Het
Itih4 T C 14: 30,901,663 F930L probably benign Het
Kcnh8 A G 17: 52,956,715 T747A probably benign Het
Kit A G 5: 75,645,932 E699G probably benign Het
Lamc3 T C 2: 31,921,763 S921P probably benign Het
Lrrc63 TGGCGGCGGCGGCGGCGGCGGC TGGCGGCGGCGGCGGCGGCGGCGGC 14: 75,125,221 probably benign Het
Map10 TCAGTTGTCCAG TCAG 8: 125,670,521 probably null Het
Map2k5 T C 9: 63,358,018 E76G probably damaging Het
Mgat3 G T 15: 80,211,772 E267* probably null Het
Npepps C A 11: 97,248,269 G159V probably damaging Het
Nrap A G 19: 56,335,288 V1284A probably benign Het
Olfr518 T A 7: 108,881,403 I68F probably damaging Het
Olfr792 A T 10: 129,540,693 H52L probably benign Het
Oxgr1 T C 14: 120,022,869 probably null Het
Pcdhb18 T C 18: 37,491,255 L546P possibly damaging Het
Pcdhga5 G A 18: 37,696,580 V694M probably damaging Het
Pde9a A T 17: 31,460,200 I255F possibly damaging Het
Pi4k2a G A 19: 42,090,574 G25R probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ppp1r37 A G 7: 19,534,064 I302T probably damaging Het
Prkar2a T A 9: 108,745,545 Y311N probably damaging Het
Prkd3 A T 17: 78,972,501 D254E probably benign Het
Prmt9 T C 8: 77,568,344 V439A probably benign Het
Ptpra T C 2: 130,504,206 S96P probably benign Het
Rnf103 A G 6: 71,508,930 T182A probably benign Het
Rpusd4 A G 9: 35,267,932 S15G probably benign Het
Sco1 A G 11: 67,058,393 Y229C probably damaging Het
Skint5 T A 4: 113,559,835 Q1139L unknown Het
Slc16a12 A G 19: 34,675,179 V189A probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Stard9 T C 2: 120,700,984 L2574P probably damaging Het
Syn3 A T 10: 86,055,540 probably benign Het
Tspo2 A T 17: 48,449,957 D32E probably damaging Het
Vmn1r72 A G 7: 11,669,625 F299L probably benign Het
Wdr66 A G 5: 123,254,259 probably benign Het
Xbp1 G A 11: 5,524,886 M262I probably benign Het
Zfp354b G A 11: 50,923,805 Q98* probably null Het
Other mutations in Slfn8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Slfn8 APN 11 83013484 missense possibly damaging 0.75
IGL01418:Slfn8 APN 11 83004636 missense probably damaging 1.00
IGL01620:Slfn8 APN 11 83004233 nonsense probably null
IGL01875:Slfn8 APN 11 83004079 missense probably benign 0.30
IGL01896:Slfn8 APN 11 83003696 missense probably damaging 1.00
IGL01929:Slfn8 APN 11 83003405 nonsense probably null
IGL02111:Slfn8 APN 11 83004498 missense probably damaging 1.00
IGL02136:Slfn8 APN 11 83003465 nonsense probably null
IGL02165:Slfn8 APN 11 83017196 missense probably benign 0.00
IGL02645:Slfn8 APN 11 83003554 missense possibly damaging 0.82
IGL02682:Slfn8 APN 11 83003691 missense probably damaging 1.00
IGL02689:Slfn8 APN 11 83017108 missense probably damaging 1.00
IGL02948:Slfn8 APN 11 83003252 missense probably damaging 0.99
IGL03037:Slfn8 APN 11 83003252 missense probably damaging 0.99
IGL03185:Slfn8 APN 11 83017507 missense probably benign 0.01
IGL03243:Slfn8 APN 11 83003707 missense probably damaging 1.00
IGL03286:Slfn8 APN 11 83013468 missense probably damaging 0.99
R0295:Slfn8 UTSW 11 83003343 nonsense probably null
R0368:Slfn8 UTSW 11 83017132 missense probably damaging 1.00
R0382:Slfn8 UTSW 11 83004556 missense probably damaging 1.00
R0655:Slfn8 UTSW 11 83003821 missense probably benign 0.35
R0894:Slfn8 UTSW 11 83003581 missense probably benign 0.07
R1006:Slfn8 UTSW 11 83003511 missense possibly damaging 0.69
R1181:Slfn8 UTSW 11 83016745 missense probably benign 0.19
R1187:Slfn8 UTSW 11 83003488 missense probably damaging 1.00
R1501:Slfn8 UTSW 11 83003180 missense probably damaging 0.99
R1646:Slfn8 UTSW 11 83016886 missense probably damaging 1.00
R1909:Slfn8 UTSW 11 83003621 nonsense probably null
R2005:Slfn8 UTSW 11 83004150 missense probably damaging 1.00
R2363:Slfn8 UTSW 11 83004094 missense probably damaging 1.00
R3780:Slfn8 UTSW 11 83017454 missense probably benign 0.13
R3890:Slfn8 UTSW 11 83004444 missense possibly damaging 0.68
R3917:Slfn8 UTSW 11 83016993 nonsense probably null
R4559:Slfn8 UTSW 11 83004744 missense probably damaging 1.00
R4684:Slfn8 UTSW 11 83017506 missense probably benign 0.10
R4767:Slfn8 UTSW 11 83003197 missense possibly damaging 0.66
R4773:Slfn8 UTSW 11 83017393 missense probably damaging 1.00
R4859:Slfn8 UTSW 11 83017714 start codon destroyed probably null 0.99
R4916:Slfn8 UTSW 11 83016878 missense probably damaging 1.00
R4939:Slfn8 UTSW 11 83003285 missense probably benign 0.01
R5107:Slfn8 UTSW 11 83017150 missense probably damaging 0.99
R5130:Slfn8 UTSW 11 83003821 missense probably benign 0.35
R5165:Slfn8 UTSW 11 83017127 missense probably damaging 0.99
R5238:Slfn8 UTSW 11 83013388 missense probably damaging 0.96
R5282:Slfn8 UTSW 11 83017724 critical splice acceptor site probably null
R5311:Slfn8 UTSW 11 83004084 missense probably damaging 1.00
R5499:Slfn8 UTSW 11 83004216 missense probably damaging 0.99
R5617:Slfn8 UTSW 11 83004721 missense probably benign 0.01
R5782:Slfn8 UTSW 11 83017041 missense probably damaging 0.98
R5823:Slfn8 UTSW 11 83016736 missense probably benign 0.01
R5886:Slfn8 UTSW 11 83003334 missense probably benign 0.09
R5933:Slfn8 UTSW 11 83003335 missense probably benign 0.00
R6151:Slfn8 UTSW 11 83017321 missense probably damaging 1.00
R6163:Slfn8 UTSW 11 83003864 makesense probably null
R6191:Slfn8 UTSW 11 83016800 missense possibly damaging 0.72
R6419:Slfn8 UTSW 11 83004055 unclassified probably null
R6925:Slfn8 UTSW 11 83013417 nonsense probably null
R7065:Slfn8 UTSW 11 83016968 missense probably benign 0.01
R7380:Slfn8 UTSW 11 83003740 missense not run
R7414:Slfn8 UTSW 11 83016792 nonsense probably null
X0021:Slfn8 UTSW 11 83016928 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CTTACCGGATGAAGTCCCTC -3'
(R):5'- GTCATGACCAAGGTTCTCTGC -3'

Sequencing Primer
(F):5'- ATGAAGTCCCTCAATGGCTG -3'
(R):5'- ATGACCAAGGTTCTCTGCCTGAG -3'
Posted On2019-12-03