Incidental Mutation 'R7819:Crppa'
ID 601774
Institutional Source Beutler Lab
Gene Symbol Crppa
Ensembl Gene ENSMUSG00000043153
Gene Name CDP-L-ribitol pyrophosphorylase A
Synonyms Ispd, 4930579E17Rik
MMRRC Submission 045873-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7819 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 36431449-36739502 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36431902 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 44 (T44A)
Ref Sequence ENSEMBL: ENSMUSP00000152872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062041] [ENSMUST00000171007] [ENSMUST00000220519] [ENSMUST00000221177] [ENSMUST00000221452] [ENSMUST00000221895] [ENSMUST00000223205] [ENSMUST00000223068]
AlphaFold Q5RJG7
Predicted Effect probably benign
Transcript: ENSMUST00000062041
AA Change: T44A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000061646
Gene: ENSMUSG00000043153
AA Change: T44A

DomainStartEndE-ValueType
Pfam:IspD 45 277 2.5e-40 PFAM
Pfam:NTP_transf_3 47 274 3.1e-11 PFAM
low complexity region 359 370 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000171007
AA Change: V32A
SMART Domains Protein: ENSMUSP00000131751
Gene: ENSMUSG00000091007
AA Change: V32A

DomainStartEndE-ValueType
low complexity region 148 163 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220519
AA Change: T44A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000221177
Predicted Effect probably benign
Transcript: ENSMUST00000221452
AA Change: T44A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000221895
AA Change: T44A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000223205
AA Change: T44A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000223068
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase-like protein. Mutations in this gene are the cause of Walker-Warburg syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit neonatal lethality due to respiratory failure, abnormal axon guidance and fasciculation, abnormal dorsal funiculus, detachment of radial glial cell endfeet and neuronal heterotopias. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik C G 6: 52,156,254 (GRCm39) probably benign Het
Abcg3 T C 5: 105,125,594 (GRCm39) T30A probably benign Het
Adra1b A T 11: 43,726,194 (GRCm39) V241D probably damaging Het
Ahctf1 A T 1: 179,595,880 (GRCm39) N170K probably benign Het
Ahr A G 12: 35,559,999 (GRCm39) L218P probably damaging Het
Apol8 C T 15: 77,633,959 (GRCm39) V206M probably damaging Het
Arhgap11a T A 2: 113,665,263 (GRCm39) probably null Het
B3galnt1 T C 3: 69,483,108 (GRCm39) Y51C probably damaging Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Capn3 T C 2: 120,294,646 (GRCm39) V98A probably benign Het
Casp12 T C 9: 5,352,805 (GRCm39) L209P probably damaging Het
Ccdc96 A T 5: 36,643,329 (GRCm39) Q445L probably damaging Het
Cdc37 A G 9: 21,052,260 (GRCm39) S301P probably damaging Het
Cep89 A T 7: 35,131,968 (GRCm39) H634L probably benign Het
Cert1 A T 13: 96,765,575 (GRCm39) T447S possibly damaging Het
Cfap251 A G 5: 123,392,322 (GRCm39) probably benign Het
Chmp3 T A 6: 71,538,008 (GRCm39) Y12* probably null Het
Clgn A T 8: 84,134,829 (GRCm39) I156F possibly damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 105,036,334 (GRCm39) probably null Het
Crb2 T A 2: 37,681,603 (GRCm39) N815K probably benign Het
Csgalnact2 A C 6: 118,098,050 (GRCm39) L97V possibly damaging Het
Ctsh T A 9: 89,942,556 (GRCm39) M37K possibly damaging Het
D630003M21Rik T C 2: 158,058,718 (GRCm39) E394G probably damaging Het
Ddx31 T G 2: 28,782,463 (GRCm39) L602R probably damaging Het
Defb40 T A 8: 19,025,050 (GRCm39) Y52F probably benign Het
Dip2a A G 10: 76,126,862 (GRCm39) V710A probably benign Het
Dnah2 T C 11: 69,407,419 (GRCm39) I150V probably benign Het
Eln A T 5: 134,766,035 (GRCm39) L56Q unknown Het
Ezh1 T C 11: 101,085,740 (GRCm39) N639S probably damaging Het
Fzd3 A G 14: 65,472,775 (GRCm39) F331S probably damaging Het
Gbp9 T C 5: 105,251,745 (GRCm39) T68A possibly damaging Het
Gltp A G 5: 114,812,161 (GRCm39) M104T probably benign Het
Gmps G A 3: 63,893,048 (GRCm39) V118M probably damaging Het
Gpsm1 T C 2: 26,229,705 (GRCm39) L42P probably damaging Het
Hsfy2 T A 1: 56,675,418 (GRCm39) H373L probably benign Het
Ica1l A T 1: 60,054,953 (GRCm39) F93I possibly damaging Het
Idh1 A G 1: 65,204,277 (GRCm39) S278P probably damaging Het
Ighmbp2 C T 19: 3,317,276 (GRCm39) G532D possibly damaging Het
Ikbkb A G 8: 23,161,742 (GRCm39) L382S probably benign Het
Il1rap T A 16: 26,541,151 (GRCm39) M464K possibly damaging Het
Ing2 G A 8: 48,122,063 (GRCm39) R162C probably damaging Het
Ints1 A T 5: 139,746,522 (GRCm39) L1275H probably damaging Het
Itga1 T C 13: 115,185,837 (GRCm39) E55G probably damaging Het
Itih4 T C 14: 30,623,620 (GRCm39) F930L probably benign Het
Kcnh8 A G 17: 53,263,743 (GRCm39) T747A probably benign Het
Kit A G 5: 75,806,592 (GRCm39) E699G probably benign Het
Lamc3 T C 2: 31,811,775 (GRCm39) S921P probably benign Het
Lrrc63 TGGCGGCGGCGGCGGCGGCGGC TGGCGGCGGCGGCGGCGGCGGCGGC 14: 75,362,661 (GRCm39) probably benign Het
Map10 TCAGTTGTCCAG TCAG 8: 126,397,260 (GRCm39) probably null Het
Map2k5 T C 9: 63,265,300 (GRCm39) E76G probably damaging Het
Mgat3 G T 15: 80,095,973 (GRCm39) E267* probably null Het
Nhsl3 A G 4: 129,116,276 (GRCm39) V841A probably benign Het
Npepps C A 11: 97,139,095 (GRCm39) G159V probably damaging Het
Nrap A G 19: 56,323,720 (GRCm39) V1284A probably benign Het
Or10a3 T A 7: 108,480,610 (GRCm39) I68F probably damaging Het
Or6c66b A T 10: 129,376,562 (GRCm39) H52L probably benign Het
Oxgr1 T C 14: 120,260,281 (GRCm39) probably null Het
Pcdhb18 T C 18: 37,624,308 (GRCm39) L546P possibly damaging Het
Pcdhga5 G A 18: 37,829,633 (GRCm39) V694M probably damaging Het
Pde9a A T 17: 31,679,174 (GRCm39) I255F possibly damaging Het
Pi4k2a G A 19: 42,079,013 (GRCm39) G25R probably benign Het
Plscr4 C T 9: 92,372,843 (GRCm39) R322* probably null Het
Ppp1r37 A G 7: 19,267,989 (GRCm39) I302T probably damaging Het
Prkar2a T A 9: 108,622,744 (GRCm39) Y311N probably damaging Het
Prkd3 A T 17: 79,279,930 (GRCm39) D254E probably benign Het
Prmt9 T C 8: 78,294,973 (GRCm39) V439A probably benign Het
Ptpra T C 2: 130,346,126 (GRCm39) S96P probably benign Het
Rnf103 A G 6: 71,485,914 (GRCm39) T182A probably benign Het
Rpusd4 A G 9: 35,179,228 (GRCm39) S15G probably benign Het
Sco1 A G 11: 66,949,219 (GRCm39) Y229C probably damaging Het
Skint5 T A 4: 113,417,032 (GRCm39) Q1139L unknown Het
Slc16a12 A G 19: 34,652,579 (GRCm39) V189A probably damaging Het
Slfn8 T G 11: 82,895,081 (GRCm39) N575T probably damaging Het
Sorbs1 G C 19: 40,365,244 (GRCm39) R180G probably benign Het
Stard9 T C 2: 120,531,465 (GRCm39) L2574P probably damaging Het
Syn3 A T 10: 85,891,404 (GRCm39) probably benign Het
Tspo2 A T 17: 48,756,985 (GRCm39) D32E probably damaging Het
Vmn1r72 A G 7: 11,403,552 (GRCm39) F299L probably benign Het
Xbp1 G A 11: 5,474,886 (GRCm39) M262I probably benign Het
Zfp354b G A 11: 50,814,632 (GRCm39) Q98* probably null Het
Zfp582 A C 7: 6,357,165 (GRCm39) H326P probably damaging Het
Other mutations in Crppa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01753:Crppa APN 12 36,523,176 (GRCm39) missense probably damaging 1.00
IGL01845:Crppa APN 12 36,597,918 (GRCm39) missense probably benign 0.10
R0329:Crppa UTSW 12 36,431,837 (GRCm39) missense possibly damaging 0.71
R0513:Crppa UTSW 12 36,440,467 (GRCm39) missense probably damaging 1.00
R0798:Crppa UTSW 12 36,571,998 (GRCm39) missense probably benign 0.26
R1676:Crppa UTSW 12 36,526,720 (GRCm39) missense probably benign 0.02
R1704:Crppa UTSW 12 36,571,493 (GRCm39) missense probably benign 0.00
R1937:Crppa UTSW 12 36,440,367 (GRCm39) missense probably benign 0.13
R1987:Crppa UTSW 12 36,571,995 (GRCm39) missense probably damaging 1.00
R4518:Crppa UTSW 12 36,523,179 (GRCm39) missense possibly damaging 0.81
R5726:Crppa UTSW 12 36,597,829 (GRCm39) missense probably damaging 0.99
R6508:Crppa UTSW 12 36,476,298 (GRCm39) missense possibly damaging 0.92
R7315:Crppa UTSW 12 36,440,373 (GRCm39) missense probably benign 0.00
R7395:Crppa UTSW 12 36,551,994 (GRCm39) missense possibly damaging 0.86
R8392:Crppa UTSW 12 36,440,497 (GRCm39) missense probably damaging 1.00
R8810:Crppa UTSW 12 36,440,481 (GRCm39) missense probably damaging 1.00
R9280:Crppa UTSW 12 36,571,975 (GRCm39) missense probably benign 0.02
R9401:Crppa UTSW 12 36,552,073 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTTCCATCTGCACCTCGAG -3'
(R):5'- TCCTAGAGCAGGTATTCCTCGG -3'

Sequencing Primer
(F):5'- TGCACCTCGAGCTTCTGCG -3'
(R):5'- AACCGAAAGTCCCTGGGTC -3'
Posted On 2019-12-03