Incidental Mutation 'R7819:Oxgr1'
ID601780
Institutional Source Beutler Lab
Gene Symbol Oxgr1
Ensembl Gene ENSMUSG00000044819
Gene Nameoxoglutarate (alpha-ketoglutarate) receptor 1
SynonymsLOC239283, Gpr99, P2Y15, Cysltr3, Gpr80
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7819 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location120019585-120042435 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 120022869 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000055137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058213] [ENSMUST00000058213]
Predicted Effect probably null
Transcript: ENSMUST00000058213
SMART Domains Protein: ENSMUSP00000055137
Gene: ENSMUSG00000044819

DomainStartEndE-ValueType
Pfam:7tm_1 50 302 3.8e-35 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000058213
SMART Domains Protein: ENSMUSP00000055137
Gene: ENSMUSG00000044819

DomainStartEndE-ValueType
Pfam:7tm_1 50 302 3.8e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor (GPCR) that belongs to the oxoglutarate receptor family within the GPCR superfamily. The encoded protein is activated by the citric acid intermediate, oxoglutarate, as well as several cysteinyl leukotrienes, including leukotrienes E4, C4 and D4, which are implicated in many inflammatory disorders. In mice, a knock-out of this gene leads to middle ear inflammation, changes in the mucosal epithelium, and an increase in fluid behind the eardrum, and is associated with hearing loss. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced leukotriene E4 ligand (LTE4)-induced ear edema at low and intermediate doses and abnormal acid-base balance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik C G 6: 52,179,274 probably benign Het
Abcg3 T C 5: 104,977,728 T30A probably benign Het
Adra1b A T 11: 43,835,367 V241D probably damaging Het
Ahctf1 A T 1: 179,768,315 N170K probably benign Het
Ahr A G 12: 35,510,000 L218P probably damaging Het
Apol8 C T 15: 77,749,759 V206M probably damaging Het
Arhgap11a T A 2: 113,834,918 probably null Het
B3galnt1 T C 3: 69,575,775 Y51C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C77080 A G 4: 129,222,483 V841A probably benign Het
Capn3 T C 2: 120,464,165 V98A probably benign Het
Casp12 T C 9: 5,352,805 L209P probably damaging Het
Ccdc96 A T 5: 36,485,985 Q445L probably damaging Het
Cdc37 A G 9: 21,140,964 S301P probably damaging Het
Cep89 A T 7: 35,432,543 H634L probably benign Het
Chmp3 T A 6: 71,561,024 Y12* probably null Het
Clgn A T 8: 83,408,200 I156F possibly damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
Col4a3bp A T 13: 96,629,067 T447S possibly damaging Het
Crb2 T A 2: 37,791,591 N815K probably benign Het
Csgalnact2 A C 6: 118,121,089 L97V possibly damaging Het
Ctsh T A 9: 90,060,503 M37K possibly damaging Het
D630003M21Rik T C 2: 158,216,798 E394G probably damaging Het
Ddx31 T G 2: 28,892,451 L602R probably damaging Het
Defb40 T A 8: 18,975,034 Y52F probably benign Het
Dip2a A G 10: 76,291,028 V710A probably benign Het
Dnah2 T C 11: 69,516,593 I150V probably benign Het
Eln A T 5: 134,737,181 L56Q unknown Het
Ezh1 T C 11: 101,194,914 N639S probably damaging Het
Fzd3 A G 14: 65,235,326 F331S probably damaging Het
Gbp9 T C 5: 105,103,879 T68A possibly damaging Het
Gltp A G 5: 114,674,100 M104T probably benign Het
Gm3854 A C 7: 6,354,166 H326P probably damaging Het
Gmps G A 3: 63,985,627 V118M probably damaging Het
Gpsm1 T C 2: 26,339,693 L42P probably damaging Het
Hsfy2 T A 1: 56,636,259 H373L probably benign Het
Ica1l A T 1: 60,015,794 F93I possibly damaging Het
Idh1 A G 1: 65,165,118 S278P probably damaging Het
Ighmbp2 C T 19: 3,267,276 G532D possibly damaging Het
Ikbkb A G 8: 22,671,726 L382S probably benign Het
Il1rap T A 16: 26,722,401 M464K possibly damaging Het
Ing2 G A 8: 47,669,028 R162C probably damaging Het
Ints1 A T 5: 139,760,767 L1275H probably damaging Het
Ispd A G 12: 36,381,903 T44A probably benign Het
Itga1 T C 13: 115,049,301 E55G probably damaging Het
Itih4 T C 14: 30,901,663 F930L probably benign Het
Kcnh8 A G 17: 52,956,715 T747A probably benign Het
Kit A G 5: 75,645,932 E699G probably benign Het
Lamc3 T C 2: 31,921,763 S921P probably benign Het
Lrrc63 TGGCGGCGGCGGCGGCGGCGGC TGGCGGCGGCGGCGGCGGCGGCGGC 14: 75,125,221 probably benign Het
Map10 TCAGTTGTCCAG TCAG 8: 125,670,521 probably null Het
Map2k5 T C 9: 63,358,018 E76G probably damaging Het
Mgat3 G T 15: 80,211,772 E267* probably null Het
Npepps C A 11: 97,248,269 G159V probably damaging Het
Nrap A G 19: 56,335,288 V1284A probably benign Het
Olfr518 T A 7: 108,881,403 I68F probably damaging Het
Olfr792 A T 10: 129,540,693 H52L probably benign Het
Pcdhb18 T C 18: 37,491,255 L546P possibly damaging Het
Pcdhga5 G A 18: 37,696,580 V694M probably damaging Het
Pde9a A T 17: 31,460,200 I255F possibly damaging Het
Pi4k2a G A 19: 42,090,574 G25R probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ppp1r37 A G 7: 19,534,064 I302T probably damaging Het
Prkar2a T A 9: 108,745,545 Y311N probably damaging Het
Prkd3 A T 17: 78,972,501 D254E probably benign Het
Prmt9 T C 8: 77,568,344 V439A probably benign Het
Ptpra T C 2: 130,504,206 S96P probably benign Het
Rnf103 A G 6: 71,508,930 T182A probably benign Het
Rpusd4 A G 9: 35,267,932 S15G probably benign Het
Sco1 A G 11: 67,058,393 Y229C probably damaging Het
Skint5 T A 4: 113,559,835 Q1139L unknown Het
Slc16a12 A G 19: 34,675,179 V189A probably damaging Het
Slfn8 T G 11: 83,004,255 N575T probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Stard9 T C 2: 120,700,984 L2574P probably damaging Het
Syn3 A T 10: 86,055,540 probably benign Het
Tspo2 A T 17: 48,449,957 D32E probably damaging Het
Vmn1r72 A G 7: 11,669,625 F299L probably benign Het
Wdr66 A G 5: 123,254,259 probably benign Het
Xbp1 G A 11: 5,524,886 M262I probably benign Het
Zfp354b G A 11: 50,923,805 Q98* probably null Het
Other mutations in Oxgr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02167:Oxgr1 APN 14 120021930 missense probably damaging 0.97
IGL02678:Oxgr1 APN 14 120022168 missense probably damaging 1.00
IGL03387:Oxgr1 APN 14 120022787 nonsense probably null
IGL03394:Oxgr1 APN 14 120022610 missense possibly damaging 0.65
R1615:Oxgr1 UTSW 14 120022773 missense probably benign 0.25
R2919:Oxgr1 UTSW 14 120022809 start gained probably benign
R4223:Oxgr1 UTSW 14 120022613 missense probably damaging 1.00
R4409:Oxgr1 UTSW 14 120022160 missense possibly damaging 0.67
R4783:Oxgr1 UTSW 14 120022364 missense probably benign
R5213:Oxgr1 UTSW 14 120022140 nonsense probably null
R5226:Oxgr1 UTSW 14 120022253 missense probably damaging 1.00
R6416:Oxgr1 UTSW 14 120022448 missense probably damaging 0.99
R6491:Oxgr1 UTSW 14 120022007 missense probably benign 0.01
R6670:Oxgr1 UTSW 14 120022257 missense probably damaging 1.00
R6904:Oxgr1 UTSW 14 120022019 missense possibly damaging 0.90
R7089:Oxgr1 UTSW 14 120022202 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGGGAAGGTACTGCATCTTG -3'
(R):5'- CTACAGTGTTGCAATTCATGACAG -3'

Sequencing Primer
(F):5'- CTGCATCTTGAATGAGATTTGCTC -3'
(R):5'- AGATATCACCAACCTAGCCTTTGTGG -3'
Posted On2019-12-03