Incidental Mutation 'R7819:Kcnh8'
ID601786
Institutional Source Beutler Lab
Gene Symbol Kcnh8
Ensembl Gene ENSMUSG00000035580
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 8
SynonymsELK1, C130090D05Rik, Kv12.1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7819 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location52602709-52979194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52956715 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 747 (T747A)
Ref Sequence ENSEMBL: ENSMUSP00000049206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039366]
Predicted Effect probably benign
Transcript: ENSMUST00000039366
AA Change: T747A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049206
Gene: ENSMUSG00000035580
AA Change: T747A

DomainStartEndE-ValueType
Blast:PAS 16 88 9e-35 BLAST
PAC 94 136 3.42e-9 SMART
Pfam:Ion_trans 221 481 4.9e-36 PFAM
Pfam:Ion_trans_2 411 475 1.1e-12 PFAM
cNMP 551 666 1.17e-16 SMART
low complexity region 710 722 N/A INTRINSIC
coiled coil region 853 897 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik C G 6: 52,179,274 probably benign Het
Abcg3 T C 5: 104,977,728 T30A probably benign Het
Adra1b A T 11: 43,835,367 V241D probably damaging Het
Ahctf1 A T 1: 179,768,315 N170K probably benign Het
Ahr A G 12: 35,510,000 L218P probably damaging Het
Apol8 C T 15: 77,749,759 V206M probably damaging Het
Arhgap11a T A 2: 113,834,918 probably null Het
B3galnt1 T C 3: 69,575,775 Y51C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C77080 A G 4: 129,222,483 V841A probably benign Het
Capn3 T C 2: 120,464,165 V98A probably benign Het
Casp12 T C 9: 5,352,805 L209P probably damaging Het
Ccdc96 A T 5: 36,485,985 Q445L probably damaging Het
Cdc37 A G 9: 21,140,964 S301P probably damaging Het
Cep89 A T 7: 35,432,543 H634L probably benign Het
Chmp3 T A 6: 71,561,024 Y12* probably null Het
Clgn A T 8: 83,408,200 I156F possibly damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
Col4a3bp A T 13: 96,629,067 T447S possibly damaging Het
Crb2 T A 2: 37,791,591 N815K probably benign Het
Csgalnact2 A C 6: 118,121,089 L97V possibly damaging Het
Ctsh T A 9: 90,060,503 M37K possibly damaging Het
D630003M21Rik T C 2: 158,216,798 E394G probably damaging Het
Ddx31 T G 2: 28,892,451 L602R probably damaging Het
Defb40 T A 8: 18,975,034 Y52F probably benign Het
Dip2a A G 10: 76,291,028 V710A probably benign Het
Dnah2 T C 11: 69,516,593 I150V probably benign Het
Eln A T 5: 134,737,181 L56Q unknown Het
Ezh1 T C 11: 101,194,914 N639S probably damaging Het
Fzd3 A G 14: 65,235,326 F331S probably damaging Het
Gbp9 T C 5: 105,103,879 T68A possibly damaging Het
Gltp A G 5: 114,674,100 M104T probably benign Het
Gm3854 A C 7: 6,354,166 H326P probably damaging Het
Gmps G A 3: 63,985,627 V118M probably damaging Het
Gpsm1 T C 2: 26,339,693 L42P probably damaging Het
Hsfy2 T A 1: 56,636,259 H373L probably benign Het
Ica1l A T 1: 60,015,794 F93I possibly damaging Het
Idh1 A G 1: 65,165,118 S278P probably damaging Het
Ighmbp2 C T 19: 3,267,276 G532D possibly damaging Het
Ikbkb A G 8: 22,671,726 L382S probably benign Het
Il1rap T A 16: 26,722,401 M464K possibly damaging Het
Ing2 G A 8: 47,669,028 R162C probably damaging Het
Ints1 A T 5: 139,760,767 L1275H probably damaging Het
Ispd A G 12: 36,381,903 T44A probably benign Het
Itga1 T C 13: 115,049,301 E55G probably damaging Het
Itih4 T C 14: 30,901,663 F930L probably benign Het
Kit A G 5: 75,645,932 E699G probably benign Het
Lamc3 T C 2: 31,921,763 S921P probably benign Het
Lrrc63 TGGCGGCGGCGGCGGCGGCGGC TGGCGGCGGCGGCGGCGGCGGCGGC 14: 75,125,221 probably benign Het
Map10 TCAGTTGTCCAG TCAG 8: 125,670,521 probably null Het
Map2k5 T C 9: 63,358,018 E76G probably damaging Het
Mgat3 G T 15: 80,211,772 E267* probably null Het
Npepps C A 11: 97,248,269 G159V probably damaging Het
Nrap A G 19: 56,335,288 V1284A probably benign Het
Olfr518 T A 7: 108,881,403 I68F probably damaging Het
Olfr792 A T 10: 129,540,693 H52L probably benign Het
Oxgr1 T C 14: 120,022,869 probably null Het
Pcdhb18 T C 18: 37,491,255 L546P possibly damaging Het
Pcdhga5 G A 18: 37,696,580 V694M probably damaging Het
Pde9a A T 17: 31,460,200 I255F possibly damaging Het
Pi4k2a G A 19: 42,090,574 G25R probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ppp1r37 A G 7: 19,534,064 I302T probably damaging Het
Prkar2a T A 9: 108,745,545 Y311N probably damaging Het
Prkd3 A T 17: 78,972,501 D254E probably benign Het
Prmt9 T C 8: 77,568,344 V439A probably benign Het
Ptpra T C 2: 130,504,206 S96P probably benign Het
Rnf103 A G 6: 71,508,930 T182A probably benign Het
Rpusd4 A G 9: 35,267,932 S15G probably benign Het
Sco1 A G 11: 67,058,393 Y229C probably damaging Het
Skint5 T A 4: 113,559,835 Q1139L unknown Het
Slc16a12 A G 19: 34,675,179 V189A probably damaging Het
Slfn8 T G 11: 83,004,255 N575T probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Stard9 T C 2: 120,700,984 L2574P probably damaging Het
Syn3 A T 10: 86,055,540 probably benign Het
Tspo2 A T 17: 48,449,957 D32E probably damaging Het
Vmn1r72 A G 7: 11,669,625 F299L probably benign Het
Wdr66 A G 5: 123,254,259 probably benign Het
Xbp1 G A 11: 5,524,886 M262I probably benign Het
Zfp354b G A 11: 50,923,805 Q98* probably null Het
Other mutations in Kcnh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Kcnh8 APN 17 52834680 missense probably damaging 1.00
IGL01901:Kcnh8 APN 17 52894120 splice site probably benign
IGL01959:Kcnh8 APN 17 52834607 missense probably damaging 1.00
IGL02214:Kcnh8 APN 17 52877911 missense possibly damaging 0.88
IGL02528:Kcnh8 APN 17 52803528 missense probably damaging 1.00
IGL02620:Kcnh8 APN 17 52898497 missense probably damaging 0.99
IGL02688:Kcnh8 APN 17 52959443 missense probably benign 0.00
IGL02931:Kcnh8 APN 17 52956622 missense probably benign 0.00
IGL02950:Kcnh8 APN 17 52956767 missense probably benign 0.22
Incompetent UTSW 17 52894101 missense probably damaging 1.00
leak UTSW 17 52725906 small deletion probably benign
R0282:Kcnh8 UTSW 17 52725851 missense probably damaging 1.00
R0448:Kcnh8 UTSW 17 52977620 splice site probably null
R0496:Kcnh8 UTSW 17 52725858 missense probably benign 0.19
R0601:Kcnh8 UTSW 17 52894005 missense probably damaging 1.00
R0671:Kcnh8 UTSW 17 52978113 nonsense probably null
R0891:Kcnh8 UTSW 17 52905214 missense probably damaging 1.00
R0971:Kcnh8 UTSW 17 52725899 missense probably benign 0.00
R1054:Kcnh8 UTSW 17 52803484 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893960 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893961 missense probably damaging 1.00
R1565:Kcnh8 UTSW 17 52956881 missense probably benign
R1657:Kcnh8 UTSW 17 52839125 missense probably damaging 1.00
R1669:Kcnh8 UTSW 17 52893968 missense probably damaging 1.00
R1786:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R1803:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1804:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1929:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1980:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1981:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1982:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2016:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2017:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2132:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2133:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2208:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2265:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2266:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2267:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2303:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2309:Kcnh8 UTSW 17 52978039 missense probably damaging 1.00
R2760:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2764:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2857:Kcnh8 UTSW 17 52977933 missense probably benign
R2898:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2987:Kcnh8 UTSW 17 52956735 missense probably benign 0.05
R3031:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3157:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4080:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4081:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4082:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4087:Kcnh8 UTSW 17 52803400 missense possibly damaging 0.93
R4132:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4213:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4301:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4302:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4383:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4385:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4400:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4490:Kcnh8 UTSW 17 52961877 critical splice donor site probably null
R4493:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4494:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4611:Kcnh8 UTSW 17 52602836 missense probably benign 0.22
R4728:Kcnh8 UTSW 17 52725870 missense probably damaging 1.00
R4810:Kcnh8 UTSW 17 52905220 splice site probably null
R4927:Kcnh8 UTSW 17 52877981 missense probably damaging 1.00
R4984:Kcnh8 UTSW 17 52877967 missense probably damaging 1.00
R5017:Kcnh8 UTSW 17 52893930 missense probably damaging 1.00
R5214:Kcnh8 UTSW 17 52898458 missense probably damaging 1.00
R5272:Kcnh8 UTSW 17 52905015 missense probably damaging 0.97
R5386:Kcnh8 UTSW 17 52725995 missense probably benign 0.10
R5472:Kcnh8 UTSW 17 52977816 missense possibly damaging 0.71
R5500:Kcnh8 UTSW 17 52725980 missense probably benign 0.00
R5714:Kcnh8 UTSW 17 52978122 missense probably benign 0.31
R5866:Kcnh8 UTSW 17 52956776 missense probably benign 0.05
R5903:Kcnh8 UTSW 17 52803336 missense possibly damaging 0.87
R6969:Kcnh8 UTSW 17 52877943 nonsense probably null
R6994:Kcnh8 UTSW 17 52977695 missense probably benign 0.02
R7101:Kcnh8 UTSW 17 52905010 missense probably damaging 1.00
R7189:Kcnh8 UTSW 17 52894117 splice site probably null
R7228:Kcnh8 UTSW 17 52956716 missense probably benign 0.01
R7372:Kcnh8 UTSW 17 52894101 missense probably damaging 1.00
R7751:Kcnh8 UTSW 17 52961843 missense probably damaging 1.00
R7952:Kcnh8 UTSW 17 52959465 missense probably benign 0.02
R8176:Kcnh8 UTSW 17 52978094 missense probably damaging 1.00
R8190:Kcnh8 UTSW 17 52956908 missense probably damaging 1.00
R8407:Kcnh8 UTSW 17 52905073 missense probably damaging 1.00
R8473:Kcnh8 UTSW 17 52978292 missense probably benign
R8716:Kcnh8 UTSW 17 52977752 missense probably benign 0.02
RF009:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF010:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF011:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF021:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF022:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
Z1088:Kcnh8 UTSW 17 52725890 missense probably damaging 1.00
Z1088:Kcnh8 UTSW 17 52978292 missense probably benign
Z1176:Kcnh8 UTSW 17 52894061 missense probably damaging 0.98
Z1177:Kcnh8 UTSW 17 52803471 missense probably damaging 1.00
Z1177:Kcnh8 UTSW 17 52978093 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GGGAAGTCTTGGCAACTGTG -3'
(R):5'- CTTGGACTAAGCTCTGGGGTTC -3'

Sequencing Primer
(F):5'- ATCTGTCCTATTCACTATCTAGGCAG -3'
(R):5'- TTCCAGCACTACCCAGGCTG -3'
Posted On2019-12-03