Incidental Mutation 'R7819:Ighmbp2'
ID601790
Institutional Source Beutler Lab
Gene Symbol Ighmbp2
Ensembl Gene ENSMUSG00000024831
Gene Nameimmunoglobulin mu binding protein 2
Synonymssma, Smbp2, RIPE3b1, AEP, Catf1, Smbp-2, p110 subunit, Smubp2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7819 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location3260924-3283017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3267276 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 532 (G532D)
Ref Sequence ENSEMBL: ENSMUSP00000025751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025751] [ENSMUST00000119292] [ENSMUST00000154537]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025751
AA Change: G532D

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025751
Gene: ENSMUSG00000024831
AA Change: G532D

DomainStartEndE-ValueType
DEXDc 187 446 8.99e-6 SMART
AAA 205 374 9.08e-6 SMART
low complexity region 598 609 N/A INTRINSIC
R3H 704 783 1.2e-22 SMART
low complexity region 784 813 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
ZnF_AN1 895 935 5.65e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119292
AA Change: G532D

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000113438
Gene: ENSMUSG00000024831
AA Change: G532D

DomainStartEndE-ValueType
DEXDc 187 446 8.99e-6 SMART
AAA 205 374 9.08e-6 SMART
low complexity region 598 609 N/A INTRINSIC
R3H 704 783 1.2e-22 SMART
low complexity region 784 813 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154537
SMART Domains Protein: ENSMUSP00000122827
Gene: ENSMUSG00000024831

DomainStartEndE-ValueType
PDB:4B3F|X 3 160 2e-80 PDB
low complexity region 230 244 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a helicase superfamily member that binds a specific DNA sequence from the immunoglobulin mu chain switch region. Mutations in this gene lead to spinal muscle atrophy with respiratory distress type 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit premature death, progressive limb muscle atrophy, decreased grip strength, severe motor neuron and axonal degeneration, dilated cardiomyopathy, myocardial fiber necrosis, increased heart rate variability, systolic dysfunction and respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik C G 6: 52,179,274 probably benign Het
Abcg3 T C 5: 104,977,728 T30A probably benign Het
Adra1b A T 11: 43,835,367 V241D probably damaging Het
Ahctf1 A T 1: 179,768,315 N170K probably benign Het
Ahr A G 12: 35,510,000 L218P probably damaging Het
Apol8 C T 15: 77,749,759 V206M probably damaging Het
Arhgap11a T A 2: 113,834,918 probably null Het
B3galnt1 T C 3: 69,575,775 Y51C probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C77080 A G 4: 129,222,483 V841A probably benign Het
Capn3 T C 2: 120,464,165 V98A probably benign Het
Casp12 T C 9: 5,352,805 L209P probably damaging Het
Ccdc96 A T 5: 36,485,985 Q445L probably damaging Het
Cdc37 A G 9: 21,140,964 S301P probably damaging Het
Cep89 A T 7: 35,432,543 H634L probably benign Het
Chmp3 T A 6: 71,561,024 Y12* probably null Het
Clgn A T 8: 83,408,200 I156F possibly damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
Col4a3bp A T 13: 96,629,067 T447S possibly damaging Het
Crb2 T A 2: 37,791,591 N815K probably benign Het
Csgalnact2 A C 6: 118,121,089 L97V possibly damaging Het
Ctsh T A 9: 90,060,503 M37K possibly damaging Het
D630003M21Rik T C 2: 158,216,798 E394G probably damaging Het
Ddx31 T G 2: 28,892,451 L602R probably damaging Het
Defb40 T A 8: 18,975,034 Y52F probably benign Het
Dip2a A G 10: 76,291,028 V710A probably benign Het
Dnah2 T C 11: 69,516,593 I150V probably benign Het
Eln A T 5: 134,737,181 L56Q unknown Het
Ezh1 T C 11: 101,194,914 N639S probably damaging Het
Fzd3 A G 14: 65,235,326 F331S probably damaging Het
Gbp9 T C 5: 105,103,879 T68A possibly damaging Het
Gltp A G 5: 114,674,100 M104T probably benign Het
Gm3854 A C 7: 6,354,166 H326P probably damaging Het
Gmps G A 3: 63,985,627 V118M probably damaging Het
Gpsm1 T C 2: 26,339,693 L42P probably damaging Het
Hsfy2 T A 1: 56,636,259 H373L probably benign Het
Ica1l A T 1: 60,015,794 F93I possibly damaging Het
Idh1 A G 1: 65,165,118 S278P probably damaging Het
Ikbkb A G 8: 22,671,726 L382S probably benign Het
Il1rap T A 16: 26,722,401 M464K possibly damaging Het
Ing2 G A 8: 47,669,028 R162C probably damaging Het
Ints1 A T 5: 139,760,767 L1275H probably damaging Het
Ispd A G 12: 36,381,903 T44A probably benign Het
Itga1 T C 13: 115,049,301 E55G probably damaging Het
Itih4 T C 14: 30,901,663 F930L probably benign Het
Kcnh8 A G 17: 52,956,715 T747A probably benign Het
Kit A G 5: 75,645,932 E699G probably benign Het
Lamc3 T C 2: 31,921,763 S921P probably benign Het
Lrrc63 TGGCGGCGGCGGCGGCGGCGGC TGGCGGCGGCGGCGGCGGCGGCGGC 14: 75,125,221 probably benign Het
Map10 TCAGTTGTCCAG TCAG 8: 125,670,521 probably null Het
Map2k5 T C 9: 63,358,018 E76G probably damaging Het
Mgat3 G T 15: 80,211,772 E267* probably null Het
Npepps C A 11: 97,248,269 G159V probably damaging Het
Nrap A G 19: 56,335,288 V1284A probably benign Het
Olfr518 T A 7: 108,881,403 I68F probably damaging Het
Olfr792 A T 10: 129,540,693 H52L probably benign Het
Oxgr1 T C 14: 120,022,869 probably null Het
Pcdhb18 T C 18: 37,491,255 L546P possibly damaging Het
Pcdhga5 G A 18: 37,696,580 V694M probably damaging Het
Pde9a A T 17: 31,460,200 I255F possibly damaging Het
Pi4k2a G A 19: 42,090,574 G25R probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Ppp1r37 A G 7: 19,534,064 I302T probably damaging Het
Prkar2a T A 9: 108,745,545 Y311N probably damaging Het
Prkd3 A T 17: 78,972,501 D254E probably benign Het
Prmt9 T C 8: 77,568,344 V439A probably benign Het
Ptpra T C 2: 130,504,206 S96P probably benign Het
Rnf103 A G 6: 71,508,930 T182A probably benign Het
Rpusd4 A G 9: 35,267,932 S15G probably benign Het
Sco1 A G 11: 67,058,393 Y229C probably damaging Het
Skint5 T A 4: 113,559,835 Q1139L unknown Het
Slc16a12 A G 19: 34,675,179 V189A probably damaging Het
Slfn8 T G 11: 83,004,255 N575T probably damaging Het
Sorbs1 G C 19: 40,376,800 R180G probably benign Het
Stard9 T C 2: 120,700,984 L2574P probably damaging Het
Syn3 A T 10: 86,055,540 probably benign Het
Tspo2 A T 17: 48,449,957 D32E probably damaging Het
Vmn1r72 A G 7: 11,669,625 F299L probably benign Het
Wdr66 A G 5: 123,254,259 probably benign Het
Xbp1 G A 11: 5,524,886 M262I probably benign Het
Zfp354b G A 11: 50,923,805 Q98* probably null Het
Other mutations in Ighmbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Ighmbp2 APN 19 3268704 missense probably benign 0.02
IGL01160:Ighmbp2 APN 19 3276750 splice site probably benign
IGL01358:Ighmbp2 APN 19 3268817 missense probably damaging 1.00
IGL01478:Ighmbp2 APN 19 3274531 missense probably benign 0.04
IGL01509:Ighmbp2 APN 19 3268711 missense possibly damaging 0.90
IGL01557:Ighmbp2 APN 19 3281472 missense probably benign 0.13
IGL01635:Ighmbp2 APN 19 3267265 missense possibly damaging 0.94
IGL01712:Ighmbp2 APN 19 3273038 splice site probably benign
IGL01949:Ighmbp2 APN 19 3265538 missense probably benign 0.01
IGL03106:Ighmbp2 APN 19 3273022 missense possibly damaging 0.87
IGL03212:Ighmbp2 APN 19 3279942 missense probably damaging 1.00
R0038:Ighmbp2 UTSW 19 3262097 missense probably damaging 0.96
R0455:Ighmbp2 UTSW 19 3265072 missense probably benign 0.34
R1661:Ighmbp2 UTSW 19 3267246 missense probably damaging 1.00
R1756:Ighmbp2 UTSW 19 3268669 missense probably damaging 0.99
R1851:Ighmbp2 UTSW 19 3262075 missense probably benign 0.12
R2055:Ighmbp2 UTSW 19 3265095 missense probably benign 0.00
R2194:Ighmbp2 UTSW 19 3265116 missense probably benign 0.00
R3838:Ighmbp2 UTSW 19 3271658 missense probably benign 0.01
R4409:Ighmbp2 UTSW 19 3271536 missense probably benign
R4583:Ighmbp2 UTSW 19 3265324 missense probably benign 0.01
R4806:Ighmbp2 UTSW 19 3261589 missense probably damaging 1.00
R5091:Ighmbp2 UTSW 19 3265084 missense possibly damaging 0.55
R5274:Ighmbp2 UTSW 19 3265518 missense probably damaging 1.00
R5319:Ighmbp2 UTSW 19 3271646 missense probably damaging 0.99
R5500:Ighmbp2 UTSW 19 3268687 missense possibly damaging 0.69
R5574:Ighmbp2 UTSW 19 3271536 missense probably benign
R5698:Ighmbp2 UTSW 19 3274538 missense probably damaging 1.00
R5722:Ighmbp2 UTSW 19 3279909 missense probably damaging 1.00
R5864:Ighmbp2 UTSW 19 3261467 missense probably benign 0.00
R5980:Ighmbp2 UTSW 19 3265295 missense probably benign
R6194:Ighmbp2 UTSW 19 3262003 missense possibly damaging 0.90
R6939:Ighmbp2 UTSW 19 3276907 missense probably damaging 0.97
R7051:Ighmbp2 UTSW 19 3261462 missense probably damaging 0.98
R7147:Ighmbp2 UTSW 19 3271676 missense probably benign 0.05
R7257:Ighmbp2 UTSW 19 3266405 missense probably damaging 1.00
R7274:Ighmbp2 UTSW 19 3264951 missense probably benign
R7567:Ighmbp2 UTSW 19 3272981 missense probably benign 0.01
R7877:Ighmbp2 UTSW 19 3261490 missense probably damaging 1.00
R7960:Ighmbp2 UTSW 19 3261490 missense probably damaging 1.00
Z1177:Ighmbp2 UTSW 19 3265635 missense probably damaging 1.00
Z1177:Ighmbp2 UTSW 19 3267242 missense probably null 1.00
Z1177:Ighmbp2 UTSW 19 3271665 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGGTCAGGCTGGTAGCTAC -3'
(R):5'- CTTGGCCCAGCATAAGATCTGC -3'

Sequencing Primer
(F):5'- CAGAAACATATATGGTCTCTTGCTGG -3'
(R):5'- CTCACAACAGGCAGGAAGTGTTTC -3'
Posted On2019-12-03