Incidental Mutation 'R7820:Pdc'
ID601795
Institutional Source Beutler Lab
Gene Symbol Pdc
Ensembl Gene ENSMUSG00000006007
Gene Namephosducin
SynonymsPdc, Rpr1, Rpr-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R7820 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location150319417-150333906 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150333270 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 168 (I168T)
Ref Sequence ENSEMBL: ENSMUSP00000141136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165062] [ENSMUST00000185698] [ENSMUST00000186572] [ENSMUST00000191228]
Predicted Effect probably damaging
Transcript: ENSMUST00000165062
AA Change: I168T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131631
Gene: ENSMUSG00000006007
AA Change: I168T

DomainStartEndE-ValueType
Pfam:Phosducin 1 244 6.4e-130 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185698
SMART Domains Protein: ENSMUSP00000140669
Gene: ENSMUSG00000006007

DomainStartEndE-ValueType
Pfam:Phosducin 1 79 2.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186460
Predicted Effect probably damaging
Transcript: ENSMUST00000186572
AA Change: I168T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140843
Gene: ENSMUSG00000006007
AA Change: I168T

DomainStartEndE-ValueType
Pfam:Phosducin 1 185 1.6e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191228
AA Change: I168T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141136
Gene: ENSMUSG00000006007
AA Change: I168T

DomainStartEndE-ValueType
Pfam:Phosducin 1 244 6.4e-130 PFAM
Meta Mutation Damage Score 0.7908 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphoprotein, which is located in the outer and inner segments of the rod cells in the retina. This protein may participate in the regulation of visual phototransduction or in the integration of photoreceptor metabolism. It modulates the phototransduction cascade by interacting with the beta and gamma subunits of the retinal G-protein transducin. This gene is a potential candidate gene for retinitis pigmentosa and Usher syndrome type II. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display normal retinal morphology and rod function with reduced transducin (Gnat1) translocation. Mice homozygous for a different knock-out allele exhibit large pupils, increased blood pressure, age-related vascular smooth muscle hypertrophy, and stress-induced hypertension. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik T A 7: 50,599,623 I135N probably benign Het
Abca14 A T 7: 120,212,721 N175I probably benign Het
Adam12 A G 7: 133,998,188 V99A probably benign Het
Ankfn1 G T 11: 89,421,130 P730T probably damaging Het
Arhgap21 A G 2: 20,863,172 S847P probably damaging Het
Cacna1i C T 15: 80,372,372 A989V probably benign Het
Cacnb2 T A 2: 14,960,666 N152K probably damaging Het
Chd3 A T 11: 69,353,238 Y1334N probably damaging Het
Clca4a A T 3: 144,960,671 D473E probably damaging Het
Crhr2 A C 6: 55,102,779 I191S probably damaging Het
E430018J23Rik A T 7: 127,391,436 W460R possibly damaging Het
Eef1akmt3 T C 10: 127,033,194 Q137R possibly damaging Het
Eml1 T C 12: 108,515,174 I432T possibly damaging Het
Fcgbp A G 7: 28,120,359 T2504A probably benign Het
Hmgxb4 G T 8: 75,000,946 E186* probably null Het
Ighv16-1 T C 12: 114,068,969 N71S probably benign Het
Kif2b A G 11: 91,577,274 V61A probably benign Het
Map1b C T 13: 99,431,177 G1679R unknown Het
Mast4 G A 13: 102,754,088 S1086L probably damaging Het
Mcm8 A G 2: 132,840,772 E724G possibly damaging Het
Mfap5 C A 6: 122,520,921 D51E probably damaging Het
Mon1a T C 9: 107,901,312 L245P probably damaging Het
Mtx1 G T 3: 89,214,008 H106Q probably benign Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ngp A G 9: 110,420,864 T77A probably benign Het
Oca2 A T 7: 56,331,965 I612F probably damaging Het
Odf3 A C 7: 140,849,263 T128P probably benign Het
Olfr1224-ps1 T A 2: 89,156,248 D309V probably benign Het
Olfr147 A T 9: 38,403,566 I228F probably damaging Het
Olfr96 A T 17: 37,225,895 M257L probably benign Het
Otop3 T A 11: 115,339,588 V97D probably damaging Het
Ovgp1 A G 3: 105,986,521 probably benign Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plekha7 A T 7: 116,237,480 F18I probably benign Het
Plppr4 A G 3: 117,321,949 I753T possibly damaging Het
Pms2 T G 5: 143,914,633 S123A possibly damaging Het
Pou4f2 T A 8: 78,436,502 probably benign Het
Ptch1 A T 13: 63,523,061 L885Q probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rgs11 T A 17: 26,205,195 probably null Het
Samd3 T A 10: 26,233,518 probably null Het
Slit3 A G 11: 35,700,408 D1349G probably benign Het
Sorbs2 A T 8: 45,796,556 Q868L probably null Het
Speer4f1 T A 5: 17,479,530 S185R probably damaging Het
Spin2f A G X: 31,254,699 K28R probably benign Het
Tas2r125 T G 6: 132,909,878 I76M probably benign Het
Tex15 A T 8: 33,575,062 I1507F probably damaging Het
Tmem2 C T 19: 21,807,461 A436V probably damaging Het
Vmn1r215 A T 13: 23,076,545 I252F probably damaging Het
Vmn1r71 A G 7: 10,748,725 F12S possibly damaging Het
Zfp128 A G 7: 12,891,022 Y439C probably benign Het
Other mutations in Pdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Pdc APN 1 150333255 missense probably damaging 0.99
IGL02537:Pdc APN 1 150333009 missense possibly damaging 0.68
R0349:Pdc UTSW 1 150333427 missense probably benign 0.07
R0502:Pdc UTSW 1 150328414 splice site probably benign
R1167:Pdc UTSW 1 150333245 missense probably damaging 1.00
R1717:Pdc UTSW 1 150333141 missense probably damaging 1.00
R5182:Pdc UTSW 1 150333354 missense possibly damaging 0.84
R5449:Pdc UTSW 1 150333439 missense probably damaging 1.00
R5766:Pdc UTSW 1 150333500 makesense probably null
R6020:Pdc UTSW 1 150333366 missense probably benign 0.16
R6181:Pdc UTSW 1 150333270 missense probably damaging 1.00
R6425:Pdc UTSW 1 150333372 missense probably benign 0.37
R6660:Pdc UTSW 1 150333335 missense probably damaging 1.00
R6717:Pdc UTSW 1 150333018 missense probably damaging 1.00
R6925:Pdc UTSW 1 150333180 missense probably damaging 1.00
R7716:Pdc UTSW 1 150330783 missense probably benign 0.06
R8030:Pdc UTSW 1 150333213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGAAGTTGAGTTTTGGGCC -3'
(R):5'- CCATGTTGGTCTGCTCTAGGTC -3'

Sequencing Primer
(F):5'- CCTAGGTATGGGTTTGTGTATGAGC -3'
(R):5'- GGTCTGCTCTAGGTCATGTATCTC -3'
Posted On2019-12-03