Incidental Mutation 'R7820:Olfr1224-ps1'
ID601798
Institutional Source Beutler Lab
Gene Symbol Olfr1224-ps1
Ensembl Gene ENSMUSG00000075099
Gene Nameolfactory receptor 1224, pseudogene 1
SynonymsGA_x6K02T2Q125-50635980-50635046, MOR233-15
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7820 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location89155336-89164091 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89156248 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 309 (D309V)
Ref Sequence ENSEMBL: ENSMUSP00000148938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099792] [ENSMUST00000099793] [ENSMUST00000216833] [ENSMUST00000216976] [ENSMUST00000217342]
Predicted Effect probably benign
Transcript: ENSMUST00000099792
AA Change: D309V

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000097380
Gene: ENSMUSG00000075099
AA Change: D309V

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.1e-48 PFAM
Pfam:7tm_1 39 287 9.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099793
AA Change: D309V

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000097381
Gene: ENSMUSG00000075099
AA Change: D309V

DomainStartEndE-ValueType
Pfam:7tm_1 39 286 2e-26 PFAM
Pfam:7tm_4 138 283 5.6e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216833
AA Change: D309V

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000216976
AA Change: D309V

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000217342
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik T A 7: 50,599,623 I135N probably benign Het
Abca14 A T 7: 120,212,721 N175I probably benign Het
Adam12 A G 7: 133,998,188 V99A probably benign Het
Ankfn1 G T 11: 89,421,130 P730T probably damaging Het
Arhgap21 A G 2: 20,863,172 S847P probably damaging Het
Cacna1i C T 15: 80,372,372 A989V probably benign Het
Cacnb2 T A 2: 14,960,666 N152K probably damaging Het
Chd3 A T 11: 69,353,238 Y1334N probably damaging Het
Clca4a A T 3: 144,960,671 D473E probably damaging Het
Crhr2 A C 6: 55,102,779 I191S probably damaging Het
E430018J23Rik A T 7: 127,391,436 W460R possibly damaging Het
Eef1akmt3 T C 10: 127,033,194 Q137R possibly damaging Het
Eml1 T C 12: 108,515,174 I432T possibly damaging Het
Fcgbp A G 7: 28,120,359 T2504A probably benign Het
Hmgxb4 G T 8: 75,000,946 E186* probably null Het
Ighv16-1 T C 12: 114,068,969 N71S probably benign Het
Kif2b A G 11: 91,577,274 V61A probably benign Het
Map1b C T 13: 99,431,177 G1679R unknown Het
Mast4 G A 13: 102,754,088 S1086L probably damaging Het
Mcm8 A G 2: 132,840,772 E724G possibly damaging Het
Mfap5 C A 6: 122,520,921 D51E probably damaging Het
Mon1a T C 9: 107,901,312 L245P probably damaging Het
Mtx1 G T 3: 89,214,008 H106Q probably benign Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ngp A G 9: 110,420,864 T77A probably benign Het
Oca2 A T 7: 56,331,965 I612F probably damaging Het
Odf3 A C 7: 140,849,263 T128P probably benign Het
Olfr147 A T 9: 38,403,566 I228F probably damaging Het
Olfr96 A T 17: 37,225,895 M257L probably benign Het
Otop3 T A 11: 115,339,588 V97D probably damaging Het
Ovgp1 A G 3: 105,986,521 probably benign Het
Pdc T C 1: 150,333,270 I168T probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plekha7 A T 7: 116,237,480 F18I probably benign Het
Plppr4 A G 3: 117,321,949 I753T possibly damaging Het
Pms2 T G 5: 143,914,633 S123A possibly damaging Het
Pou4f2 T A 8: 78,436,502 probably benign Het
Ptch1 A T 13: 63,523,061 L885Q probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rgs11 T A 17: 26,205,195 probably null Het
Samd3 T A 10: 26,233,518 probably null Het
Slit3 A G 11: 35,700,408 D1349G probably benign Het
Sorbs2 A T 8: 45,796,556 Q868L probably null Het
Speer4f1 T A 5: 17,479,530 S185R probably damaging Het
Spin2f A G X: 31,254,699 K28R probably benign Het
Tas2r125 T G 6: 132,909,878 I76M probably benign Het
Tex15 A T 8: 33,575,062 I1507F probably damaging Het
Tmem2 C T 19: 21,807,461 A436V probably damaging Het
Vmn1r215 A T 13: 23,076,545 I252F probably damaging Het
Vmn1r71 A G 7: 10,748,725 F12S possibly damaging Het
Zfp128 A G 7: 12,891,022 Y439C probably benign Het
Other mutations in Olfr1224-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Olfr1224-ps1 APN 2 89156917 missense probably benign 0.01
IGL02561:Olfr1224-ps1 APN 2 89157141 missense possibly damaging 0.94
R0086:Olfr1224-ps1 UTSW 2 89156476 missense probably benign 0.01
R0096:Olfr1224-ps1 UTSW 2 89156296 missense probably benign 0.03
R0096:Olfr1224-ps1 UTSW 2 89156296 missense probably benign 0.03
R0783:Olfr1224-ps1 UTSW 2 89156891 missense probably benign 0.30
R1920:Olfr1224-ps1 UTSW 2 89156581 missense probably benign 0.44
R1921:Olfr1224-ps1 UTSW 2 89156581 missense probably benign 0.44
R2033:Olfr1224-ps1 UTSW 2 89157154 missense probably damaging 0.96
R3500:Olfr1224-ps1 UTSW 2 89157059 missense probably damaging 1.00
R5044:Olfr1224-ps1 UTSW 2 89156939 nonsense probably null
R5140:Olfr1224-ps1 UTSW 2 89157107 missense probably benign 0.12
R5253:Olfr1224-ps1 UTSW 2 89156457 nonsense probably null
R6338:Olfr1224-ps1 UTSW 2 89156371 missense probably damaging 1.00
R6431:Olfr1224-ps1 UTSW 2 89157161 missense probably damaging 1.00
R6904:Olfr1224-ps1 UTSW 2 89156813 missense possibly damaging 0.57
R7259:Olfr1224-ps1 UTSW 2 89156510 missense probably benign 0.03
Z1176:Olfr1224-ps1 UTSW 2 89156467 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGGAGCTCCTAGTAAATTGATACC -3'
(R):5'- ACCACAGTTCTGAAGGTCGG -3'

Sequencing Primer
(F):5'- CGTAGTTGTACTGGGATCG -3'
(R):5'- GCGTAAAGCTCTCTCTACCTGTGG -3'
Posted On2019-12-03