Incidental Mutation 'R7820:Mcm8'
ID601799
Institutional Source Beutler Lab
Gene Symbol Mcm8
Ensembl Gene ENSMUSG00000027353
Gene Nameminichromosome maintenance 8 homologous recombination repair factor
Synonyms5730432L01Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.508) question?
Stock #R7820 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location132816141-132844197 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132840772 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 724 (E724G)
Ref Sequence ENSEMBL: ENSMUSP00000028831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028831] [ENSMUST00000066559]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028831
AA Change: E724G

PolyPhen 2 Score 0.684 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028831
Gene: ENSMUSG00000027353
AA Change: E724G

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
Blast:MCM 79 155 2e-28 BLAST
MCM 198 742 2.42e-136 SMART
AAA 439 590 5.99e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066559
AA Change: E696G

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000066842
Gene: ENSMUSG00000027353
AA Change: E696G

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:MCM 51 127 2e-28 BLAST
MCM 170 714 2.42e-136 SMART
AAA 411 562 5.99e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the mini-chromosome maintenance proteins is a key component of the pre-replication complex and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein contains the central domain that is conserved among the mini-chromosome maintenance proteins. The encoded protein may interact with other mini-chromosome maintenance proteins and play a role in DNA replication. This gene may be associated with length of reproductive lifespan and menopause. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female and male infertility associated with impaired ovarian development and arrested male meiosis, and impaired sensitivity to homologous recombination double-strand break repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik T A 7: 50,599,623 I135N probably benign Het
Abca14 A T 7: 120,212,721 N175I probably benign Het
Adam12 A G 7: 133,998,188 V99A probably benign Het
Ankfn1 G T 11: 89,421,130 P730T probably damaging Het
Arhgap21 A G 2: 20,863,172 S847P probably damaging Het
Cacna1i C T 15: 80,372,372 A989V probably benign Het
Cacnb2 T A 2: 14,960,666 N152K probably damaging Het
Chd3 A T 11: 69,353,238 Y1334N probably damaging Het
Clca4a A T 3: 144,960,671 D473E probably damaging Het
Crhr2 A C 6: 55,102,779 I191S probably damaging Het
E430018J23Rik A T 7: 127,391,436 W460R possibly damaging Het
Eef1akmt3 T C 10: 127,033,194 Q137R possibly damaging Het
Eml1 T C 12: 108,515,174 I432T possibly damaging Het
Fcgbp A G 7: 28,120,359 T2504A probably benign Het
Hmgxb4 G T 8: 75,000,946 E186* probably null Het
Ighv16-1 T C 12: 114,068,969 N71S probably benign Het
Kif2b A G 11: 91,577,274 V61A probably benign Het
Map1b C T 13: 99,431,177 G1679R unknown Het
Mast4 G A 13: 102,754,088 S1086L probably damaging Het
Mfap5 C A 6: 122,520,921 D51E probably damaging Het
Mon1a T C 9: 107,901,312 L245P probably damaging Het
Mtx1 G T 3: 89,214,008 H106Q probably benign Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ngp A G 9: 110,420,864 T77A probably benign Het
Oca2 A T 7: 56,331,965 I612F probably damaging Het
Odf3 A C 7: 140,849,263 T128P probably benign Het
Olfr1224-ps1 T A 2: 89,156,248 D309V probably benign Het
Olfr147 A T 9: 38,403,566 I228F probably damaging Het
Olfr96 A T 17: 37,225,895 M257L probably benign Het
Otop3 T A 11: 115,339,588 V97D probably damaging Het
Ovgp1 A G 3: 105,986,521 probably benign Het
Pdc T C 1: 150,333,270 I168T probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plekha7 A T 7: 116,237,480 F18I probably benign Het
Plppr4 A G 3: 117,321,949 I753T possibly damaging Het
Pms2 T G 5: 143,914,633 S123A possibly damaging Het
Pou4f2 T A 8: 78,436,502 probably benign Het
Ptch1 A T 13: 63,523,061 L885Q probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rgs11 T A 17: 26,205,195 probably null Het
Samd3 T A 10: 26,233,518 probably null Het
Slit3 A G 11: 35,700,408 D1349G probably benign Het
Sorbs2 A T 8: 45,796,556 Q868L probably null Het
Speer4f1 T A 5: 17,479,530 S185R probably damaging Het
Spin2f A G X: 31,254,699 K28R probably benign Het
Tas2r125 T G 6: 132,909,878 I76M probably benign Het
Tex15 A T 8: 33,575,062 I1507F probably damaging Het
Tmem2 C T 19: 21,807,461 A436V probably damaging Het
Vmn1r215 A T 13: 23,076,545 I252F probably damaging Het
Vmn1r71 A G 7: 10,748,725 F12S possibly damaging Het
Zfp128 A G 7: 12,891,022 Y439C probably benign Het
Other mutations in Mcm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Mcm8 APN 2 132827537 missense probably benign
IGL00479:Mcm8 APN 2 132817174 missense probably benign
IGL00573:Mcm8 APN 2 132832812 missense possibly damaging 0.94
IGL00847:Mcm8 APN 2 132819674 missense probably benign 0.29
IGL00978:Mcm8 APN 2 132821406 missense probably benign
IGL01390:Mcm8 APN 2 132838078 splice site probably benign
IGL01785:Mcm8 APN 2 132827948 missense probably benign 0.05
IGL01786:Mcm8 APN 2 132827948 missense probably benign 0.05
IGL02216:Mcm8 APN 2 132839529 missense probably damaging 1.00
IGL03191:Mcm8 APN 2 132821442 missense possibly damaging 0.68
madamina UTSW 2 132832854 missense probably damaging 1.00
PIT4687001:Mcm8 UTSW 2 132817177 missense possibly damaging 0.54
R0329:Mcm8 UTSW 2 132819994 missense possibly damaging 0.64
R0330:Mcm8 UTSW 2 132819994 missense possibly damaging 0.64
R1520:Mcm8 UTSW 2 132839455 missense probably benign 0.39
R1771:Mcm8 UTSW 2 132843556 nonsense probably null
R1967:Mcm8 UTSW 2 132842742 missense probably benign
R2228:Mcm8 UTSW 2 132820121 missense possibly damaging 0.85
R2418:Mcm8 UTSW 2 132824738 missense probably benign
R4728:Mcm8 UTSW 2 132832854 missense probably damaging 1.00
R4827:Mcm8 UTSW 2 132823254 missense probably damaging 0.99
R4847:Mcm8 UTSW 2 132820003 missense probably benign 0.01
R4928:Mcm8 UTSW 2 132839479 missense probably benign 0.00
R4932:Mcm8 UTSW 2 132838709 missense probably benign 0.09
R4962:Mcm8 UTSW 2 132838769 missense probably damaging 1.00
R6044:Mcm8 UTSW 2 132831680 critical splice donor site probably null
R6081:Mcm8 UTSW 2 132828083 missense probably benign 0.00
R6650:Mcm8 UTSW 2 132821407 missense probably benign 0.01
R6685:Mcm8 UTSW 2 132842650 missense probably damaging 1.00
R7006:Mcm8 UTSW 2 132823261 missense probably damaging 1.00
R7176:Mcm8 UTSW 2 132820072 missense probably benign 0.01
R7328:Mcm8 UTSW 2 132832857 missense probably benign 0.28
R7486:Mcm8 UTSW 2 132839520 missense probably damaging 1.00
R7631:Mcm8 UTSW 2 132828043 missense not run
R7664:Mcm8 UTSW 2 132843533 missense probably damaging 0.96
R8090:Mcm8 UTSW 2 132831649 missense probably benign 0.30
R8228:Mcm8 UTSW 2 132842794 critical splice donor site probably null
Z1176:Mcm8 UTSW 2 132827567 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTCCTGAAATGAGCACTCAG -3'
(R):5'- TCTGCCATACTTCCCCAAAG -3'

Sequencing Primer
(F):5'- GTAGGTAAAAGTACATTCTGGCTG -3'
(R):5'- TGTCGGCCAGGACTGACATC -3'
Posted On2019-12-03