Incidental Mutation 'R7820:Crhr2'
ID601808
Institutional Source Beutler Lab
Gene Symbol Crhr2
Ensembl Gene ENSMUSG00000003476
Gene Namecorticotropin releasing hormone receptor 2
SynonymsCRF-R2, CRH-R2, Crfr2, CRF 2 receptor, CRFR2beta, CRFR2alpha
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R7820 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location55090049-55133016 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 55102779 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 191 (I191S)
Ref Sequence ENSEMBL: ENSMUSP00000003568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003568] [ENSMUST00000095898] [ENSMUST00000114374] [ENSMUST00000164012] [ENSMUST00000212633] [ENSMUST00000213026]
Predicted Effect probably damaging
Transcript: ENSMUST00000003568
AA Change: I191S

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000003568
Gene: ENSMUSG00000003476
AA Change: I191S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
HormR 56 127 3.55e-28 SMART
Pfam:7tm_2 132 374 8.4e-79 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000095898
AA Change: H135Q

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000093586
Gene: ENSMUSG00000003476
AA Change: H135Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
HormR 36 107 1.75e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114374
AA Change: I171S

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110015
Gene: ENSMUSG00000003476
AA Change: I171S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
HormR 36 107 3.55e-28 SMART
Pfam:7tm_2 112 354 9.7e-80 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000126673
Gene: ENSMUSG00000003476
AA Change: I192S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
HormR 56 127 3.55e-28 SMART
Pfam:7tm_2 132 374 1e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212633
AA Change: I192S

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213026
AA Change: I172S

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the G-protein coupled receptor 2 family, and the subfamily of corticotropin releasing hormone receptor. This receptor shows high affinity for corticotropin releasing hormone (CRH), and also binds CRH-related peptides such as urocortin. CRH is synthesized in the hypothalamus, and plays an important role in coordinating the endocrine, autonomic, and behavioral responses to stress and immune challenge. Studies in mice suggest that this receptor maybe involved in mediating cardiovascular homeostasis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous inactivation of this gene may result in hypersensitivity to stress, increased anxiety-like behavior, abnormal homeostatic responses to challenges of increased dietary fat and cold, and cardiovascular abnormalities, including hypertension and decreased cardiac contractility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik T A 7: 50,599,623 I135N probably benign Het
Abca14 A T 7: 120,212,721 N175I probably benign Het
Adam12 A G 7: 133,998,188 V99A probably benign Het
Ankfn1 G T 11: 89,421,130 P730T probably damaging Het
Arhgap21 A G 2: 20,863,172 S847P probably damaging Het
Cacna1i C T 15: 80,372,372 A989V probably benign Het
Cacnb2 T A 2: 14,960,666 N152K probably damaging Het
Chd3 A T 11: 69,353,238 Y1334N probably damaging Het
Clca4a A T 3: 144,960,671 D473E probably damaging Het
E430018J23Rik A T 7: 127,391,436 W460R possibly damaging Het
Eef1akmt3 T C 10: 127,033,194 Q137R possibly damaging Het
Eml1 T C 12: 108,515,174 I432T possibly damaging Het
Fcgbp A G 7: 28,120,359 T2504A probably benign Het
Hmgxb4 G T 8: 75,000,946 E186* probably null Het
Ighv16-1 T C 12: 114,068,969 N71S probably benign Het
Kif2b A G 11: 91,577,274 V61A probably benign Het
Map1b C T 13: 99,431,177 G1679R unknown Het
Mast4 G A 13: 102,754,088 S1086L probably damaging Het
Mcm8 A G 2: 132,840,772 E724G possibly damaging Het
Mfap5 C A 6: 122,520,921 D51E probably damaging Het
Mon1a T C 9: 107,901,312 L245P probably damaging Het
Mtx1 G T 3: 89,214,008 H106Q probably benign Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ngp A G 9: 110,420,864 T77A probably benign Het
Oca2 A T 7: 56,331,965 I612F probably damaging Het
Odf3 A C 7: 140,849,263 T128P probably benign Het
Olfr1224-ps1 T A 2: 89,156,248 D309V probably benign Het
Olfr147 A T 9: 38,403,566 I228F probably damaging Het
Olfr96 A T 17: 37,225,895 M257L probably benign Het
Otop3 T A 11: 115,339,588 V97D probably damaging Het
Ovgp1 A G 3: 105,986,521 probably benign Het
Pdc T C 1: 150,333,270 I168T probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plekha7 A T 7: 116,237,480 F18I probably benign Het
Plppr4 A G 3: 117,321,949 I753T possibly damaging Het
Pms2 T G 5: 143,914,633 S123A possibly damaging Het
Pou4f2 T A 8: 78,436,502 probably benign Het
Ptch1 A T 13: 63,523,061 L885Q probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rgs11 T A 17: 26,205,195 probably null Het
Samd3 T A 10: 26,233,518 probably null Het
Slit3 A G 11: 35,700,408 D1349G probably benign Het
Sorbs2 A T 8: 45,796,556 Q868L probably null Het
Speer4f1 T A 5: 17,479,530 S185R probably damaging Het
Spin2f A G X: 31,254,699 K28R probably benign Het
Tas2r125 T G 6: 132,909,878 I76M probably benign Het
Tex15 A T 8: 33,575,062 I1507F probably damaging Het
Tmem2 C T 19: 21,807,461 A436V probably damaging Het
Vmn1r215 A T 13: 23,076,545 I252F probably damaging Het
Vmn1r71 A G 7: 10,748,725 F12S possibly damaging Het
Zfp128 A G 7: 12,891,022 Y439C probably benign Het
Other mutations in Crhr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02173:Crhr2 APN 6 55103180 missense probably damaging 1.00
R0278:Crhr2 UTSW 6 55117531 missense probably benign 0.16
R1056:Crhr2 UTSW 6 55100735 missense probably damaging 1.00
R1701:Crhr2 UTSW 6 55099270 missense probably damaging 1.00
R1702:Crhr2 UTSW 6 55092535 missense probably damaging 1.00
R2697:Crhr2 UTSW 6 55102830 missense probably damaging 1.00
R4020:Crhr2 UTSW 6 55100780 splice site probably benign
R4030:Crhr2 UTSW 6 55117677 missense probably benign 0.34
R4527:Crhr2 UTSW 6 55132853 utr 5 prime probably benign
R4698:Crhr2 UTSW 6 55102867 missense possibly damaging 0.90
R4737:Crhr2 UTSW 6 55091305 missense probably damaging 1.00
R5437:Crhr2 UTSW 6 55100733 missense probably damaging 1.00
R5718:Crhr2 UTSW 6 55092100 nonsense probably null
R5719:Crhr2 UTSW 6 55103222 missense probably damaging 1.00
R5945:Crhr2 UTSW 6 55100682 missense possibly damaging 0.93
R6046:Crhr2 UTSW 6 55091292 missense probably damaging 1.00
R6358:Crhr2 UTSW 6 55093043 missense probably benign 0.20
R6826:Crhr2 UTSW 6 55117740 intron probably benign
R7011:Crhr2 UTSW 6 55099210 critical splice donor site probably null
R7131:Crhr2 UTSW 6 55092127 missense
Z1088:Crhr2 UTSW 6 55103216 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- ACCTGGATTTGTAAGGTGGACC -3'
(R):5'- TCCTTAGGCTCTGGTTCAGC -3'

Sequencing Primer
(F):5'- CAGGGCATGCAGTGATAGCTTTAG -3'
(R):5'- CAGGCAGTGTCGTTCCCAAC -3'
Posted On2019-12-03