Incidental Mutation 'R7820:4933405O20Rik'
ID601814
Institutional Source Beutler Lab
Gene Symbol 4933405O20Rik
Ensembl Gene ENSMUSG00000084234
Gene NameRIKEN cDNA 4933405O20 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R7820 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location50599190-50600530 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50599623 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 135 (I135N)
Ref Sequence ENSEMBL: ENSMUSP00000138215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081872] [ENSMUST00000107603] [ENSMUST00000119710]
Predicted Effect probably benign
Transcript: ENSMUST00000081872
SMART Domains Protein: ENSMUSP00000080550
Gene: ENSMUSG00000055409

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 29 213 8.5e-72 SMART
LamG 81 208 1.77e-14 SMART
coiled coil region 240 266 N/A INTRINSIC
VWC 273 331 1.45e-6 SMART
VWC 335 389 1.34e0 SMART
EGF 394 433 1.06e0 SMART
EGF_CA 434 475 7.93e-9 SMART
EGF 479 516 1.1e-2 SMART
EGF 518 547 8.32e-3 SMART
EGF_CA 549 595 1.08e-10 SMART
EGF_like 596 635 1.84e-4 SMART
VWC 634 686 1.42e0 SMART
VWC 694 749 1.83e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107603
SMART Domains Protein: ENSMUSP00000103229
Gene: ENSMUSG00000055409

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 29 213 8.5e-72 SMART
LamG 81 208 1.77e-14 SMART
coiled coil region 240 266 N/A INTRINSIC
VWC 273 331 1.45e-6 SMART
VWC 335 389 1.34e0 SMART
EGF 394 433 1.06e0 SMART
EGF_CA 434 475 7.93e-9 SMART
EGF 479 516 1.1e-2 SMART
EGF 518 547 8.32e-3 SMART
EGF_like 549 588 1.84e-4 SMART
VWC 587 639 1.42e0 SMART
VWC 647 702 1.83e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119710
AA Change: I135N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138215
Gene: ENSMUSG00000084234
AA Change: I135N

DomainStartEndE-ValueType
Iso_dh 53 376 8.22e-118 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,212,721 N175I probably benign Het
Adam12 A G 7: 133,998,188 V99A probably benign Het
Ankfn1 G T 11: 89,421,130 P730T probably damaging Het
Arhgap21 A G 2: 20,863,172 S847P probably damaging Het
Cacna1i C T 15: 80,372,372 A989V probably benign Het
Cacnb2 T A 2: 14,960,666 N152K probably damaging Het
Chd3 A T 11: 69,353,238 Y1334N probably damaging Het
Clca4a A T 3: 144,960,671 D473E probably damaging Het
Crhr2 A C 6: 55,102,779 I191S probably damaging Het
E430018J23Rik A T 7: 127,391,436 W460R possibly damaging Het
Eef1akmt3 T C 10: 127,033,194 Q137R possibly damaging Het
Eml1 T C 12: 108,515,174 I432T possibly damaging Het
Fcgbp A G 7: 28,120,359 T2504A probably benign Het
Hmgxb4 G T 8: 75,000,946 E186* probably null Het
Ighv16-1 T C 12: 114,068,969 N71S probably benign Het
Kif2b A G 11: 91,577,274 V61A probably benign Het
Map1b C T 13: 99,431,177 G1679R unknown Het
Mast4 G A 13: 102,754,088 S1086L probably damaging Het
Mcm8 A G 2: 132,840,772 E724G possibly damaging Het
Mfap5 C A 6: 122,520,921 D51E probably damaging Het
Mon1a T C 9: 107,901,312 L245P probably damaging Het
Mtx1 G T 3: 89,214,008 H106Q probably benign Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ngp A G 9: 110,420,864 T77A probably benign Het
Oca2 A T 7: 56,331,965 I612F probably damaging Het
Odf3 A C 7: 140,849,263 T128P probably benign Het
Olfr1224-ps1 T A 2: 89,156,248 D309V probably benign Het
Olfr147 A T 9: 38,403,566 I228F probably damaging Het
Olfr96 A T 17: 37,225,895 M257L probably benign Het
Otop3 T A 11: 115,339,588 V97D probably damaging Het
Ovgp1 A G 3: 105,986,521 probably benign Het
Pdc T C 1: 150,333,270 I168T probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plekha7 A T 7: 116,237,480 F18I probably benign Het
Plppr4 A G 3: 117,321,949 I753T possibly damaging Het
Pms2 T G 5: 143,914,633 S123A possibly damaging Het
Pou4f2 T A 8: 78,436,502 probably benign Het
Ptch1 A T 13: 63,523,061 L885Q probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rgs11 T A 17: 26,205,195 probably null Het
Samd3 T A 10: 26,233,518 probably null Het
Slit3 A G 11: 35,700,408 D1349G probably benign Het
Sorbs2 A T 8: 45,796,556 Q868L probably null Het
Speer4f1 T A 5: 17,479,530 S185R probably damaging Het
Spin2f A G X: 31,254,699 K28R probably benign Het
Tas2r125 T G 6: 132,909,878 I76M probably benign Het
Tex15 A T 8: 33,575,062 I1507F probably damaging Het
Tmem2 C T 19: 21,807,461 A436V probably damaging Het
Vmn1r215 A T 13: 23,076,545 I252F probably damaging Het
Vmn1r71 A G 7: 10,748,725 F12S possibly damaging Het
Zfp128 A G 7: 12,891,022 Y439C probably benign Het
Other mutations in 4933405O20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02873:4933405O20Rik APN 7 50599683 missense probably damaging 0.97
IGL02941:4933405O20Rik APN 7 50599536 missense probably damaging 1.00
IGL03225:4933405O20Rik APN 7 50599920 missense probably benign 0.02
R5282:4933405O20Rik UTSW 7 50599472 missense possibly damaging 0.74
R5977:4933405O20Rik UTSW 7 50600090 missense probably damaging 1.00
R7023:4933405O20Rik UTSW 7 50600253 missense probably damaging 1.00
R7407:4933405O20Rik UTSW 7 50599878 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCAAATTGTGTGCCAGTGG -3'
(R):5'- TCTTTTGGGCCAACTTGAAGG -3'

Sequencing Primer
(F):5'- TGCCAGTGGACTTTGAAGAG -3'
(R):5'- AATGCGCACAGACTTGGTC -3'
Posted On2019-12-03