Incidental Mutation 'R7820:Oca2'
ID601815
Institutional Source Beutler Lab
Gene Symbol Oca2
Ensembl Gene ENSMUSG00000030450
Gene Nameoculocutaneous albinism II
SynonymsD7H15S12, p, D7H15S12
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R7820 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location56239760-56536518 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56331965 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 612 (I612F)
Ref Sequence ENSEMBL: ENSMUSP00000032633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032633] [ENSMUST00000144739] [ENSMUST00000152693]
Predicted Effect probably damaging
Transcript: ENSMUST00000032633
AA Change: I612F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032633
Gene: ENSMUSG00000030450
AA Change: I612F

DomainStartEndE-ValueType
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ArsB 319 558 2e-10 PFAM
Pfam:CitMHS 337 770 2e-49 PFAM
Pfam:ArsB 562 827 8.9e-9 PFAM
Pfam:Na_sulph_symp 573 832 6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144739
Predicted Effect probably benign
Transcript: ENSMUST00000152693
SMART Domains Protein: ENSMUSP00000119099
Gene: ENSMUSG00000030450

DomainStartEndE-ValueType
transmembrane domain 171 193 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human homolog of the mouse p (pink-eyed dilution) gene. The encoded protein is believed to be an integral membrane protein involved in small molecule transport, specifically tyrosine, which is a precursor to melanin synthesis. It is involved in mammalian pigmentation, where it may control skin color variation and act as a determinant of brown or blue eye color. Mutations in this gene result in type 2 oculocutaneous albinism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mutations generally result in varying degrees of coat and eye pigment dilution. Specific alleles produce cleft palate, reproductive, endocrine or neurological disorders, and/or lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405O20Rik T A 7: 50,599,623 I135N probably benign Het
Abca14 A T 7: 120,212,721 N175I probably benign Het
Adam12 A G 7: 133,998,188 V99A probably benign Het
Ankfn1 G T 11: 89,421,130 P730T probably damaging Het
Arhgap21 A G 2: 20,863,172 S847P probably damaging Het
Cacna1i C T 15: 80,372,372 A989V probably benign Het
Cacnb2 T A 2: 14,960,666 N152K probably damaging Het
Chd3 A T 11: 69,353,238 Y1334N probably damaging Het
Clca4a A T 3: 144,960,671 D473E probably damaging Het
Crhr2 A C 6: 55,102,779 I191S probably damaging Het
E430018J23Rik A T 7: 127,391,436 W460R possibly damaging Het
Eef1akmt3 T C 10: 127,033,194 Q137R possibly damaging Het
Eml1 T C 12: 108,515,174 I432T possibly damaging Het
Fcgbp A G 7: 28,120,359 T2504A probably benign Het
Hmgxb4 G T 8: 75,000,946 E186* probably null Het
Ighv16-1 T C 12: 114,068,969 N71S probably benign Het
Kif2b A G 11: 91,577,274 V61A probably benign Het
Map1b C T 13: 99,431,177 G1679R unknown Het
Mast4 G A 13: 102,754,088 S1086L probably damaging Het
Mcm8 A G 2: 132,840,772 E724G possibly damaging Het
Mfap5 C A 6: 122,520,921 D51E probably damaging Het
Mon1a T C 9: 107,901,312 L245P probably damaging Het
Mtx1 G T 3: 89,214,008 H106Q probably benign Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Ngp A G 9: 110,420,864 T77A probably benign Het
Odf3 A C 7: 140,849,263 T128P probably benign Het
Olfr1224-ps1 T A 2: 89,156,248 D309V probably benign Het
Olfr147 A T 9: 38,403,566 I228F probably damaging Het
Olfr96 A T 17: 37,225,895 M257L probably benign Het
Otop3 T A 11: 115,339,588 V97D probably damaging Het
Ovgp1 A G 3: 105,986,521 probably benign Het
Pdc T C 1: 150,333,270 I168T probably damaging Het
Peg10 CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG CCACATCAGGATCCACATCAGGATGCACATCAG 6: 4,756,398 probably benign Het
Plekha7 A T 7: 116,237,480 F18I probably benign Het
Plppr4 A G 3: 117,321,949 I753T possibly damaging Het
Pms2 T G 5: 143,914,633 S123A possibly damaging Het
Pou4f2 T A 8: 78,436,502 probably benign Het
Ptch1 A T 13: 63,523,061 L885Q probably damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rgs11 T A 17: 26,205,195 probably null Het
Samd3 T A 10: 26,233,518 probably null Het
Slit3 A G 11: 35,700,408 D1349G probably benign Het
Sorbs2 A T 8: 45,796,556 Q868L probably null Het
Speer4f1 T A 5: 17,479,530 S185R probably damaging Het
Spin2f A G X: 31,254,699 K28R probably benign Het
Tas2r125 T G 6: 132,909,878 I76M probably benign Het
Tex15 A T 8: 33,575,062 I1507F probably damaging Het
Tmem2 C T 19: 21,807,461 A436V probably damaging Het
Vmn1r215 A T 13: 23,076,545 I252F probably damaging Het
Vmn1r71 A G 7: 10,748,725 F12S possibly damaging Het
Zfp128 A G 7: 12,891,022 Y439C probably benign Het
Other mutations in Oca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Oca2 APN 7 56280846 missense probably damaging 0.99
IGL01022:Oca2 APN 7 56324756 missense probably damaging 1.00
IGL01666:Oca2 APN 7 56314811 splice site probably null
IGL02157:Oca2 APN 7 56324797 splice site probably null
IGL02213:Oca2 APN 7 56321484 splice site probably benign
IGL02314:Oca2 APN 7 56357151 missense probably benign 0.00
IGL03083:Oca2 APN 7 56295484 missense probably benign 0.28
IGL03356:Oca2 APN 7 56535968 missense probably benign 0.01
charbon UTSW 7 56316405 missense probably damaging 1.00
cotton UTSW 7 56535968 missense probably benign 0.00
Dirk UTSW 7 56535968 missense probably benign 0.00
draco1 UTSW 7 56423352 missense probably benign 0.00
faded UTSW 7 56324661 missense probably benign 0.19
hardy UTSW 7 56295460 missense probably damaging 1.00
narwhal UTSW 7 56295498 nonsense probably null
quicksilver UTSW 7 56324661 missense probably benign 0.19
renesmee UTSW 7 56535968 missense probably benign 0.00
snowflake UTSW 7 56324680 missense probably damaging 1.00
whitemouse UTSW 7 56414431 missense probably damaging 1.00
R0440:Oca2 UTSW 7 56423352 missense probably benign 0.00
R1067:Oca2 UTSW 7 56316393 missense probably damaging 1.00
R1349:Oca2 UTSW 7 56535968 missense probably benign 0.00
R1372:Oca2 UTSW 7 56535968 missense probably benign 0.00
R1457:Oca2 UTSW 7 56321521 missense probably damaging 1.00
R1737:Oca2 UTSW 7 56328785 missense probably damaging 1.00
R1802:Oca2 UTSW 7 56254980 missense possibly damaging 0.96
R1957:Oca2 UTSW 7 56321498 missense possibly damaging 0.82
R1966:Oca2 UTSW 7 56414467 missense probably damaging 0.99
R2082:Oca2 UTSW 7 56297137 missense probably benign 0.01
R2229:Oca2 UTSW 7 56357155 missense probably benign 0.11
R4120:Oca2 UTSW 7 56254882 missense probably damaging 1.00
R4192:Oca2 UTSW 7 56297249 missense probably damaging 1.00
R4405:Oca2 UTSW 7 56414434 missense possibly damaging 0.63
R4654:Oca2 UTSW 7 56328812 missense probably benign 0.44
R4701:Oca2 UTSW 7 56255002 missense probably benign 0.00
R4887:Oca2 UTSW 7 56330358 nonsense probably null
R5053:Oca2 UTSW 7 56323580 missense probably benign 0.02
R5215:Oca2 UTSW 7 56295498 nonsense probably null
R5430:Oca2 UTSW 7 56295460 missense probably damaging 1.00
R5677:Oca2 UTSW 7 56414462 missense probably damaging 1.00
R6416:Oca2 UTSW 7 56328767 missense probably benign 0.44
R6645:Oca2 UTSW 7 56314774 missense probably benign 0.21
R7257:Oca2 UTSW 7 56279538 intron probably benign
R7409:Oca2 UTSW 7 56414397 missense probably benign 0.00
R7530:Oca2 UTSW 7 56331972 missense probably damaging 0.99
Z1088:Oca2 UTSW 7 56330375 missense probably null 0.83
Predicted Primers PCR Primer
(F):5'- TCATTACCTTGTGACTCTGGG -3'
(R):5'- CCTTTGGTACAGTTATCATCTGGG -3'

Sequencing Primer
(F):5'- ACTGCTGCATATGTACCAGG -3'
(R):5'- TGGTACAGTTATCATCTGGGAATAG -3'
Posted On2019-12-03